Regulon of Zur in Oceanicaulis alexandrii HTCC2633

Properties
Regulator type:	Transcription factor
TF locus tag:	OA2633_05994
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhodobacterales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 36 sites [see more]

Member of regulog collections

By trascription factor - Zur
By taxonomy - Rhodobacterales
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 5.7 Sequence: GTGACGTTATGACATTACGTAAC Locus tag: OA2633_05989 Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
	OA2633_05989	omr	Predicted zinc-regulated TonB-dependent outer membrane transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD