Regulon of Zur in Sulfitobacter sp. EE-36

Properties
Regulator type:	Transcription factor
TF locus tag:	EE36_13033, EE36_12413
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhodobacterales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 36 sites [see more]

Member of regulog collections

By trascription factor - Zur
By taxonomy - Rhodobacterales
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 6.1 Sequence: GTTACGTTATAACATAACGAATC Locus tag: EE36_11254 Name: zinT Funciton: Candidate zinc-binding lipoprotein ZinT
	EE36_11254	zinT	Candidate zinc-binding lipoprotein ZinT
Position: -64 Score: 5.3 Sequence: GTGTTGATATGTTATAACGTGTG Locus tag: EE36_13038 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	EE36_13038	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -47 Score: 5.5 Sequence: CACACGTTATAACATATCAACAC Locus tag: EE36_13033 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: EE36_13028 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: EE36_13023 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	EE36_13033	zur	Zinc uptake regulation protein Zur
	EE36_13028	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	EE36_13023	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD