Regulon of Zur in Rhodobacter sphaeroides 2.4.1

Properties
Regulator type:	Transcription factor
TF locus tag:	RSP_3569
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhodobacterales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 36 sites [see more]

Member of regulog collections

By trascription factor - Zur
By taxonomy - Rhodobacterales
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 5.9 Sequence: GATATGTAATAACATATCATATA Locus tag: RSP_3117 Name: zinT Funciton: Candidate zinc-binding lipoprotein ZinT
	RSP_3117	zinT	Candidate zinc-binding lipoprotein ZinT
Position: -55 Score: 5.4 Sequence: GACGCGTTATGATATAACGTAAT Locus tag: RSP_3571 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	RSP_3571	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -24 Score: 5.7 Sequence: ATTACGTTATATCATAACGCGTC Locus tag: RSP_3569 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: RSP_3568 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: RSP_3567 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	RSP_3569	zur	Zinc uptake regulation protein Zur
	RSP_3568	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	RSP_3567	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD