Regulon of Zur in Hyphomonas neptunium ATCC 15444
Regulator type: | Transcription factor |
TF locus tag: | HNE_0655 |
Regulator family: | FUR |
Regulation mode: | repressor |
Biological process: | Zinc homeostasis |
Effector: | Zinc ion, (Zn2+) |
Regulog: | Zur - Rhodobacterales |
Statistics of regulated genes: | |
- Genes | 1 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By trascription factor - Zur
- By taxonomy - Rhodobacterales
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
Locus Tag | Name | Function | |
---|---|---|---|
Position: -44
Score: 5.4 Sequence: GTAATGCAATATTATTACATTAC
Locus tag: HNE_1973
Name: omr Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter |
|||
omr
|
Predicted zinc-regulated TonB-dependent outer membrane transporter
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |