Regulon of Zur in Oceanicola batsensis HTCC2597

Properties
Regulator type:	Transcription factor
TF locus tag:	OB2597_14481
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhodobacterales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 36 sites [see more]

Member of regulog collections

By trascription factor - Zur
By taxonomy - Rhodobacterales
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -30 Score: 5.2 Sequence: GCAATGTTATCTTATAACAGGAA Locus tag: OB2597_14476 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	OB2597_14476	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -116 Score: 5 Sequence: GTAACGTGATATCATAACCACAT Locus tag: OB2597_20976 Name: trxR Funciton: Thioredoxin reductase (EC 1.8.1.9) Locus tag: OB2597_20981 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	OB2597_20976	trxR	Thioredoxin reductase (EC 1.8.1.9)
	OB2597_20981	yciC	Putative zinc chaperone, COG0523 family
Position: -55 Score: 5.3 Sequence: TTCCTGTTATAAGATAACATTGC Locus tag: OB2597_14481 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: OB2597_14486 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: OB2597_14491 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	OB2597_14481	zur	Zinc uptake regulation protein Zur
	OB2597_14486	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	OB2597_14491	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD