Regulon of Zur in Rhodobacterales bacterium HTCC2654

Properties
Regulator type:	Transcription factor
TF locus tag:	RB2654_20873
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhodobacterales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 36 sites [see more]

Member of regulog collections

By trascription factor - Zur
By taxonomy - Rhodobacterales
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 5.5 Sequence: TATCTGTAATATCATAACGCATC Locus tag: RB2654_20873 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: RB2654_20878 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: RB2654_20883 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	RB2654_20873	zur	Zinc uptake regulation protein Zur
	RB2654_20878	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	RB2654_20883	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -59 Score: 5.2 Sequence: GATGCGTTATGATATTACAGATA Locus tag: RB2654_20868 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	RB2654_20868	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD