Regulon of Zur in Roseovarius nubinhibens ISM

Properties
Regulator type:	Transcription factor
TF locus tag:	ISM_14175
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Rhodobacterales
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 36 sites [see more]

Member of regulog collections

By trascription factor - Zur
By taxonomy - Rhodobacterales
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 5.4 Sequence: GTGATGTTATACTATAACAGATT Locus tag: ISM_00325 Name: yciC Funciton: Putative zinc chaperone, COG0523 family
	ISM_00325	yciC	Putative zinc chaperone, COG0523 family
Position: -115 Score: 5.5 Sequence: GATATGTTATATTATCTCATCTA Locus tag: ISM_14180 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	ISM_14180	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -54 Score: 5.6 Sequence: TAGATGAGATAATATAACATATC Locus tag: ISM_14175 Name: zur Funciton: Zinc uptake regulation protein Zur Locus tag: ISM_14170 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: ISM_14165 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	ISM_14175	zur	Zinc uptake regulation protein Zur
	ISM_14170	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	ISM_14165	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -34 Score: 5.2 Sequence: GCTACGTTATATCATAACTACTT Locus tag: ISM_05645 Name: zinT Funciton: Candidate zinc-binding lipoprotein ZinT
	ISM_05645	zinT	Candidate zinc-binding lipoprotein ZinT

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD