Regulog Zur - Pseudomonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pseudomonadaceae
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Pseudomonas aeruginosa PAO1 | 17 | 10 |
| Pseudomonas entomophila L48 | 16 | 9 |
| Pseudomonas putida KT2440 | 15 | 8 |
| Pseudomonas syringae pv. tomato str. DC3000 | 11 | 6 |
| Pseudomonas fluorescens Pf-5 | 21 | 10 |
| Pseudomonas mendocina ymp | 12 | 5 |
| Pseudomonas stutzeri A1501 | 10 | 6 |
| Azotobacter vinelandii AvOP | 12 | 7 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| folE2 |
*
Pseudomonas aeruginosa PAO1 Site: position = -63 score = 5.52655 sequence = AATACGTTATATTATAACATTCA Gene: PA5539: GTP cyclohydrolase I (EC 3.5.4.16) type 2 |
Gene: PSEEN5515: GTP cyclohydrolase I (EC 3.5.4.16) type 2 |
Gene: PP3324: GTP cyclohydrolase I (EC 3.5.4.16) type 2 |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -108 score = 5.3525 sequence = ATGATGTTATAGTGTAACGAATT Gene: PSPTO2578: GTP cyclohydrolase I (EC 3.5.4.16) type 2 |
*
Pseudomonas fluorescens Pf-5 Site: position = -50 score = 5.08307 sequence = GCATTGTTATAATATAACATGTG Gene: PFL_6177: GTP cyclohydrolase I (EC 3.5.4.16) type 2 |
*
Pseudomonas mendocina ymp Site: position = -50 score = 5.94793 sequence = CAATTGTTATAACATAACATTTA Gene: Pmen_4538: GTP cyclohydrolase I (EC 3.5.4.16) type 2 |
|
*
Azotobacter vinelandii AvOP Site: position = -118 score = 5.27403 sequence = CTTTTGTTATGTTATAACACATA Gene: Avin_29210: GTP cyclohydrolase I (EC 3.5.4.16) type 2 |
GTP cyclohydrolase I (EC 3.5.4.16) type 2 |
| znuC2 |
|
|
|
Gene: PSPTO2633: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: PFL_6178: Zinc ABC transporter, ATP-binding protein ZnuC |
|
|
|
Zinc ABC transporter, ATP-binding protein ZnuC |
| znuB2 |
|
|
|
Gene: PSPTO2634: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: PFL_6179: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
Gene: PST_3085: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
Zinc ABC transporter, inner membrane permease protein ZnuB |
| znuA2 |
|
|
|
Gene: PSPTO2635: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Gene: PFL_6180: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
|
|
Zinc ABC transporter, periplasmic-binding protein ZnuA |
| hisI2 |
|
|
*
Pseudomonas putida KT2440 Site: position = -84 score = 5.11455 sequence = TAAGTGTTATAACATAACATCTA Gene: PP3320: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
|
Gene: PFL_6181: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
Gene: Pmen_4539: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
|
|
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) |
| can |
Gene: PA5540: Carbonic anhydrase (EC 4.2.1.1) |
*
Pseudomonas entomophila L48 Site: position = -52 score = 5.44817 sequence = TAAATGTTATAATATAACAATTG Gene: PSEEN3120: Carbonic anhydrase (EC 4.2.1.1) |
|
Gene: PSPTO2579: Carbonic anhydrase (EC 4.2.1.1) |
Gene: PFL_6182: Carbonic anhydrase (EC 4.2.1.1) |
|
|
Gene: Avin_29200: Carbonic anhydrase (EC 4.2.1.1) |
Carbonic anhydrase (EC 4.2.1.1) |
| pyrC2 |
Gene: PA5541: Dihydroorotase (EC 3.5.2.3) |
Gene: PSEEN3119: Dihydroorotase (EC 3.5.2.3) |
|
|
Gene: PFL_6183: Dihydroorotase (EC 3.5.2.3) |
Gene: Pmen_4541: Dihydroorotase (EC 3.5.2.3) |
|
|
Dihydroorotase (EC 3.5.2.3) |
| PP3321 |
|
|
*
Pseudomonas putida KT2440 Site: position = -3 score = 5.2972 sequence = TAGATGTTATGTTATAACACTTA Gene: PP3321: hypothetical protein |
Gene: PSPTO2132: hypothetical protein |
Gene: PFL_3821: hypothetical protein |
Gene: Pmen_4181: hypothetical protein |
Gene: PST_1096: hypothetical protein |
|
hypothetical protein |
| hemB2 |
|
|
Gene: PP3322: Porphobilinogen synthase (EC 4.2.1.24) |
|
|
|
|
|
Porphobilinogen synthase (EC 4.2.1.24) |
| yciC3 |
|
|
Gene: PP3323: Putative metal chaperone, GTPase of COG0523 family |
|
|
|
|
|
Putative metal chaperone, GTPase of COG0523 family |
| DUF37 |
|
|
|
|
|
Gene: Pmen_4540: Protein of unknown function DUF37 |
|
|
Protein of unknown function DUF37 |
| dksA2 |
*
Pseudomonas aeruginosa PAO1 Site: position = -43 score = 5.54042 sequence = TAATTGTTATAGTATAACGTTTT Gene: PA5536: C4-type zinc finger protein, DksA/TraR family |
Gene: PSEEN3118: C4-type zinc finger protein, DksA/TraR family |
|
|
*
Pseudomonas fluorescens Pf-5 Site: position = -48 score = 5.93557 sequence = GTGTTGTTATAATATAACATAAA Gene: PFL_6174: C4-type zinc finger protein, DksA/TraR family |
*
Pseudomonas mendocina ymp Site: position = -44 score = 5.06285 sequence = TAAATGTTATGTTATAACAATTG Gene: Pmen_4537: C4-type zinc finger protein, DksA/TraR family |
*
Pseudomonas stutzeri A1501 Site: position = -90 score = 4.69604 sequence = TAAACGTTATGTTATAACTAATC Gene: PST_3603: C4-type zinc finger protein, DksA/TraR family |
*
Azotobacter vinelandii AvOP Site: position = -119 score = 5.22936 sequence = AAAATGTTATGTTATAACTATAA Gene: Avin_22970: C4-type zinc finger protein, DksA/TraR family |
C4-type zinc finger protein, DksA/TraR family |
| yciC |
Gene: PA5535: Putative metal chaperone, GTPase of COG0523 family |
*
Pseudomonas entomophila L48 Site: position = -70 score = 4.57183 sequence = AAATTGTATTGTTATAATATAAC Site: position = -65 score = 5.85945 sequence = GTATTGTTATAATATAACATTGC Gene: PSEEN5513: Putative metal chaperone, GTPase of COG0523 family |
*
Pseudomonas putida KT2440 Site: position = -65 score = 5.09009 sequence = GTATTGTTACCTTATAACATTAT Gene: PP5361: Putative metal chaperone, GTPase of COG0523 family |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -108 score = 5.39966 sequence = GTGTTGTTATACTATAACATCAT Gene: PSPTO5526: Putative metal chaperone, GTPase of COG0523 family |
Gene: PFL_6173: Putative metal chaperone, GTPase of COG0523 family |
Gene: Pmen_4536: Putative metal chaperone, GTPase of COG0523 family |
Gene: PST_3604: Putative metal chaperone, GTPase of COG0523 family |
Gene: Avin_22980: Putative metal chaperone, GTPase of COG0523 family |
Putative metal chaperone, GTPase of COG0523 family |
| PF08856 |
Gene: PA5534: hypothetical protein |
Gene: PSEEN5512: hypothetical protein |
Gene: PP5360: hypothetical protein |
Gene: PSPTO5525: hypothetical protein |
Gene: PFL_6172: hypothetical protein |
Gene: Pmen_4535: hypothetical protein |
Gene: PST_3605: hypothetical protein |
Gene: Avin_22990: hypothetical protein |
hypothetical protein |
| yciC2 |
Gene: PA5532: Putative metal chaperone, GTPase of COG0523 family |
Gene: PSEEN5511: Putative metal chaperone, GTPase of COG0523 family |
Gene: PP5359: Putative metal chaperone, GTPase of COG0523 family |
Gene: PSPTO5523: Putative metal chaperone, GTPase of COG0523 family |
Gene: PFL_6171: Putative metal chaperone, GTPase of COG0523 family |
Gene: Pmen_4533: Putative metal chaperone, GTPase of COG0523 family |
Gene: PST_4179: Putative metal chaperone, GTPase of COG0523 family |
Gene: Avin_01740: Putative metal chaperone, GTPase of COG0523 family |
Putative metal chaperone, GTPase of COG0523 family |
| PA4838 |
*
Pseudomonas aeruginosa PAO1 Site: position = -122 score = 5.09085 sequence = GAAATGATATACTATAACGCTAC Gene: PA4838: membrane protein-like protein |
*
Pseudomonas entomophila L48 Site: position = -62 score = 5.30657 sequence = AAAAAGATATAAGATAACATTTC Gene: PSEEN2389: membrane protein-like protein |
Gene: PP2419: membrane protein-like protein |
Gene: PSPTO2580: membrane protein-like protein |
|
|
*
Pseudomonas stutzeri A1501 Site: position = -113 score = 5.17287 sequence = CTTTTGTTATAACGTATCGCACC Gene: PST_2941: membrane protein-like protein |
|
membrane protein-like protein |
| PA5537 |
*
Pseudomonas aeruginosa PAO1 Site: position = -92 score = 5.16189 sequence = AAAACGTTATACTATAACAATTA Gene: PA5537: hypothetical protein |
*
Pseudomonas entomophila L48 Site: position = -67 score = 5.4493 sequence = GCAATGTTATATTATAACAATAC Gene: PSEEN5514: hypothetical protein |
*
Pseudomonas putida KT2440 Site: position = -72 score = 5.81849 sequence = ATAATGTTATAAGGTAACAATAC Gene: PP5362: hypothetical protein |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -56 score = 5.53758 sequence = ATGATGTTATAGTATAACAACAC Gene: PSPTO5527: hypothetical protein |
*
Pseudomonas fluorescens Pf-5 Site: position = -96 score = 5.37684 sequence = TTTATGTTATATTATAACAACAC Gene: PFL_6175: hypothetical protein |
|
|
*
Azotobacter vinelandii AvOP Site: position = -44 score = 4.78292 sequence = AAAATGTTATATAGTTTCATCCT Gene: Avin_29230: hypothetical protein |
hypothetical protein |
| CRON 2. | |||||||||
| znuA |
*
Pseudomonas aeruginosa PAO1 Site: position = -48 score = 4.63904 sequence = GAGACGTTATTATATTACCCGCT Gene: PA5498: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Pseudomonas entomophila L48 Site: position = -45 score = 4.71232 sequence = GAGACGTTATTATGTTACCTGTT Gene: PSEEN0073: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Pseudomonas putida KT2440 Site: position = -45 score = 4.71232 sequence = GAGACGTTATTATGTTACCTGTT Gene: PP0120: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -46 score = 4.71232 sequence = GAGACGTTATTATGTTACCTGTT Gene: PSPTO5268: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Pseudomonas fluorescens Pf-5 Site: position = -36 score = 4.59683 sequence = GAGACGTTATTATGTTACCCGTT Gene: PFL_0079: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Pseudomonas mendocina ymp Site: position = -45 score = 4.68428 sequence = GAGACGTTATTATATTACCCGTT Gene: Pmen_4495: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Pseudomonas stutzeri A1501 Site: position = -37 score = 4.83404 sequence = GAGACGTTATTATGTACCAATTC Gene: PST_0044: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Azotobacter vinelandii AvOP Site: position = -44 score = 4.55367 sequence = GAGACGTTATTCTATTACACTTT Gene: Avin_00830: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Zinc ABC transporter, periplasmic-binding protein ZnuA |
| CRON 3. | |||||||||
| zur |
*
Pseudomonas aeruginosa PAO1 Site: position = -44 score = 3.75427 sequence = AGCGGGTAATATAATAACGTCTC Gene: PA5499: Zinc uptake regulation protein ZUR |
*
Pseudomonas entomophila L48 Site: position = -44 score = 4.18045 sequence = AACAGGTAACATAATAACGTCTC Gene: PSEEN0072: Zinc uptake regulation protein ZUR |
*
Pseudomonas putida KT2440 Site: position = -122 score = 4.18045 sequence = AACAGGTAACATAATAACGTCTC Gene: PP0119: Zinc uptake regulation protein ZUR |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -44 score = 4.18045 sequence = AACAGGTAACATAATAACGTCTC Gene: PSPTO5267: Zinc uptake regulation protein ZUR |
*
Pseudomonas fluorescens Pf-5 Site: position = -44 score = 3.71181 sequence = AACGGGTAACATAATAACGTCTC Gene: PFL_0078: Zinc uptake regulation protein ZUR |
*
Pseudomonas mendocina ymp Site: position = -44 score = 4.0303 sequence = AACGGGTAATATAATAACGTCTC Gene: Pmen_4496: Zinc uptake regulation protein ZUR |
*
Pseudomonas stutzeri A1501 Site: position = -44 score = 4.4828 sequence = GAATTGGTACATAATAACGTCTC Gene: PST_0043: Zinc uptake regulation protein ZUR |
*
Azotobacter vinelandii AvOP Site: position = -41 score = 4.53822 sequence = AAAGTGTAATAGAATAACGTCTC Gene: Avin_00840: Zinc uptake regulation protein ZUR |
Zinc uptake regulation protein ZUR |
| znuC |
Gene: PA5500: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: PSEEN0071: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: PP0118: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: PSPTO5266: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: PFL_0077: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Pmen_4497: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: PST_0042: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: Avin_00850: Zinc ABC transporter, ATP-binding protein ZnuC |
Zinc ABC transporter, ATP-binding protein ZnuC |
| znuB |
Gene: PA5501: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: PSEEN0070: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: PP0117: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: PSPTO5265: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: PFL_0076: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Pmen_4498: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: PST_0041: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Avin_00860: Zinc ABC transporter, inner membrane permease protein ZnuB |
Zinc ABC transporter, inner membrane permease protein ZnuB |
| CRON 4. | |||||||||
| omr |
*
Pseudomonas aeruginosa PAO1 Site: position = -121 score = 4.99169 sequence = AAAAAGAAATAATATAACATCCC Gene: PA0781: Zinc-regulated outer membrane receptor |
*
Pseudomonas entomophila L48 Site: position = -51 score = 5.11772 sequence = GATACGTTATAAAGTAACAACAA Gene: PSEEN1173: Zinc-regulated outer membrane receptor |
*
Pseudomonas putida KT2440 Site: position = -53 score = 5.30419 sequence = GTTATGTTATGTTGTAACACTAA Gene: PP1446: Zinc-regulated outer membrane receptor |
|
*
Pseudomonas fluorescens Pf-5 Site: position = -113 score = 5.19502 sequence = GAGATGTTATATTGTATCAATCA Gene: PFL_4912: Zinc-regulated outer membrane receptor |
|
|
|
Zinc-regulated outer membrane receptor |
| CRON 5. | |||||||||
| amiA |
*
Pseudomonas aeruginosa PAO1 Site: position = -59 score = 5.60218 sequence = TGAATGTTATAATATAACGTATT Gene: PA5538: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28) |
|
|
Gene: PSPTO5528: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28) |
*
Pseudomonas fluorescens Pf-5 Site: position = -102 score = 5.55878 sequence = CACATGTTATATTATAACAATGC Gene: PFL_6176: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28) |
|
|
*
Azotobacter vinelandii AvOP Site: position = -68 score = 4.97953 sequence = TATGTGTTATAACATAACAAAAG Gene: Avin_29220: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28) |
N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28) |
| CRON 6. | |||||||||
| zbp |
*
Pseudomonas aeruginosa PAO1 Site: position = -51 score = 5.71676 sequence = AATTCGTTATAACGTAACAAACT Gene: PA4063: Predicted zinc-binding protein |
*
Pseudomonas entomophila L48 Site: position = -50 score = 5.61594 sequence = AAGTTGTTATAACATTACCAAAT Gene: PSEEN0582: Predicted zinc-binding protein |
*
Pseudomonas putida KT2440 Site: position = -48 score = 5.74973 sequence = ATCTTGTTATAACATAACCCTAT Gene: PP0508: Predicted zinc-binding protein |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -54 score = 5.73284 sequence = CACTTGTTATAAGATCACATAAC Gene: PSPTO0683: Predicted zinc-binding protein |
*
Pseudomonas fluorescens Pf-5 Site: position = -54 score = 5.53836 sequence = CGATTGTTATAAGATCACATAAC Gene: PFL_5528: Predicted zinc-binding protein |
*
Pseudomonas mendocina ymp Site: position = -48 score = 5.91332 sequence = AAGTTGTTATAACGTAACGATTC Gene: Pmen_3863: Predicted zinc-binding protein |
*
Pseudomonas stutzeri A1501 Site: position = -41 score = 5.98356 sequence = AAGTTGTTATAACGTAACGTACC Gene: PST_0827: Predicted zinc-binding protein |
*
Azotobacter vinelandii AvOP Site: position = -40 score = 5.83225 sequence = AACTCGTTATAACGTAACAAAAC Gene: Avin_06650: Predicted zinc-binding protein |
Predicted zinc-binding protein |
| CRON 7. | |||||||||
| rpmE2 |
*
Pseudomonas aeruginosa PAO1 Site: position = -38 score = 5.52552 sequence = AATATGTAACTATATAACATTAT Gene: PA3601: LSU ribosomal protein L31p |
*
Pseudomonas entomophila L48 Site: position = -43 score = 5.19852 sequence = AGTATGTTATAAAGTATCACTTT Gene: PSEEN1181: LSU ribosomal protein L31p |
|
Gene: PSPTO4183: LSU ribosomal protein L31p |
*
Pseudomonas fluorescens Pf-5 Site: position = -51 score = 5.28103 sequence = GATATGTTATTGTATAACGCATC Gene: PFL_4896: LSU ribosomal protein L31p |
|
*
Pseudomonas stutzeri A1501 Site: position = -51 score = 5.56736 sequence = CTATTGTTATGTTATAACATCAT Gene: PST_1798: LSU ribosomal protein L31p |
|
LSU ribosomal protein L31p |
| rpmJ |
Gene: PA3600: LSU ribosomal protein L36p |
|
|
|
*
Pseudomonas fluorescens Pf-5 Site: position = -47 score = 4.7526 sequence = AATATGATATGTTATTACATTAG Gene: PFL_3806: LSU ribosomal protein L36p |
|
|
|
LSU ribosomal protein L36p |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |