Regulog Zur - Pseudomonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Pseudomonas aeruginosa PAO1	17	10
Pseudomonas entomophila L48	16	9
Pseudomonas putida KT2440	15	8
Pseudomonas syringae pv. tomato str. DC3000	11	6
Pseudomonas fluorescens Pf-5	21	10
Pseudomonas mendocina ymp	12	5
Pseudomonas stutzeri A1501	10	6
Azotobacter vinelandii AvOP	12	7

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
folE2	* Pseudomonas aeruginosa PAO1 Site: position = -63 score = 5.52655 sequence = AATACGTTATATTATAACATTCA Gene: PA5539: GTP cyclohydrolase I (EC 3.5.4.16) type 2	Pseudomonas entomophila L48 Gene: PSEEN5515: GTP cyclohydrolase I (EC 3.5.4.16) type 2	Pseudomonas putida KT2440 Gene: PP3324: GTP cyclohydrolase I (EC 3.5.4.16) type 2	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -108 score = 5.3525 sequence = ATGATGTTATAGTGTAACGAATT Gene: PSPTO2578: GTP cyclohydrolase I (EC 3.5.4.16) type 2	* Pseudomonas fluorescens Pf-5 Site: position = -50 score = 5.08307 sequence = GCATTGTTATAATATAACATGTG Gene: PFL_6177: GTP cyclohydrolase I (EC 3.5.4.16) type 2	* Pseudomonas mendocina ymp Site: position = -50 score = 5.94793 sequence = CAATTGTTATAACATAACATTTA Gene: Pmen_4538: GTP cyclohydrolase I (EC 3.5.4.16) type 2	Pseudomonas stutzeri A1501	* Azotobacter vinelandii AvOP Site: position = -118 score = 5.27403 sequence = CTTTTGTTATGTTATAACACATA Gene: Avin_29210: GTP cyclohydrolase I (EC 3.5.4.16) type 2	GTP cyclohydrolase I (EC 3.5.4.16) type 2
znuC2	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas putida KT2440	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO2633: Zinc ABC transporter, ATP-binding protein ZnuC	Pseudomonas fluorescens Pf-5 Gene: PFL_6178: Zinc ABC transporter, ATP-binding protein ZnuC	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	Zinc ABC transporter, ATP-binding protein ZnuC
znuB2	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas putida KT2440	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO2634: Zinc ABC transporter, inner membrane permease protein ZnuB	Pseudomonas fluorescens Pf-5 Gene: PFL_6179: Zinc ABC transporter, inner membrane permease protein ZnuB	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501 Gene: PST_3085: Zinc ABC transporter, inner membrane permease protein ZnuB	Azotobacter vinelandii AvOP	Zinc ABC transporter, inner membrane permease protein ZnuB
znuA2	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas putida KT2440	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO2635: Zinc ABC transporter, periplasmic-binding protein ZnuA	Pseudomonas fluorescens Pf-5 Gene: PFL_6180: Zinc ABC transporter, periplasmic-binding protein ZnuA	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	Zinc ABC transporter, periplasmic-binding protein ZnuA
hisI2	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	* Pseudomonas putida KT2440 Site: position = -84 score = 5.11455 sequence = TAAGTGTTATAACATAACATCTA Gene: PP3320: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)	Pseudomonas syringae pv. tomato str. DC3000	Pseudomonas fluorescens Pf-5 Gene: PFL_6181: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)	Pseudomonas mendocina ymp Gene: Pmen_4539: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
can	Pseudomonas aeruginosa PAO1 Gene: PA5540: Carbonic anhydrase (EC 4.2.1.1)	* Pseudomonas entomophila L48 Site: position = -52 score = 5.44817 sequence = TAAATGTTATAATATAACAATTG Gene: PSEEN3120: Carbonic anhydrase (EC 4.2.1.1)	Pseudomonas putida KT2440	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO2579: Carbonic anhydrase (EC 4.2.1.1)	Pseudomonas fluorescens Pf-5 Gene: PFL_6182: Carbonic anhydrase (EC 4.2.1.1)	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP Gene: Avin_29200: Carbonic anhydrase (EC 4.2.1.1)	Carbonic anhydrase (EC 4.2.1.1)
pyrC2	Pseudomonas aeruginosa PAO1 Gene: PA5541: Dihydroorotase (EC 3.5.2.3)	Pseudomonas entomophila L48 Gene: PSEEN3119: Dihydroorotase (EC 3.5.2.3)	Pseudomonas putida KT2440	Pseudomonas syringae pv. tomato str. DC3000	Pseudomonas fluorescens Pf-5 Gene: PFL_6183: Dihydroorotase (EC 3.5.2.3)	Pseudomonas mendocina ymp Gene: Pmen_4541: Dihydroorotase (EC 3.5.2.3)	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	Dihydroorotase (EC 3.5.2.3)
PP3321	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	* Pseudomonas putida KT2440 Site: position = -3 score = 5.2972 sequence = TAGATGTTATGTTATAACACTTA Gene: PP3321: hypothetical protein	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO2132: hypothetical protein	Pseudomonas fluorescens Pf-5 Gene: PFL_3821: hypothetical protein	Pseudomonas mendocina ymp Gene: Pmen_4181: hypothetical protein	Pseudomonas stutzeri A1501 Gene: PST_1096: hypothetical protein	Azotobacter vinelandii AvOP	hypothetical protein
hemB2	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas putida KT2440 Gene: PP3322: Porphobilinogen synthase (EC 4.2.1.24)	Pseudomonas syringae pv. tomato str. DC3000	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	Porphobilinogen synthase (EC 4.2.1.24)
yciC3	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas putida KT2440 Gene: PP3323: Putative metal chaperone, GTPase of COG0523 family	Pseudomonas syringae pv. tomato str. DC3000	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	Putative metal chaperone, GTPase of COG0523 family
DUF37	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas putida KT2440	Pseudomonas syringae pv. tomato str. DC3000	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp Gene: Pmen_4540: Protein of unknown function DUF37	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	Protein of unknown function DUF37
dksA2	* Pseudomonas aeruginosa PAO1 Site: position = -43 score = 5.54042 sequence = TAATTGTTATAGTATAACGTTTT Gene: PA5536: C4-type zinc finger protein, DksA/TraR family	Pseudomonas entomophila L48 Gene: PSEEN3118: C4-type zinc finger protein, DksA/TraR family	Pseudomonas putida KT2440	Pseudomonas syringae pv. tomato str. DC3000	* Pseudomonas fluorescens Pf-5 Site: position = -48 score = 5.93557 sequence = GTGTTGTTATAATATAACATAAA Gene: PFL_6174: C4-type zinc finger protein, DksA/TraR family	* Pseudomonas mendocina ymp Site: position = -44 score = 5.06285 sequence = TAAATGTTATGTTATAACAATTG Gene: Pmen_4537: C4-type zinc finger protein, DksA/TraR family	* Pseudomonas stutzeri A1501 Site: position = -90 score = 4.69604 sequence = TAAACGTTATGTTATAACTAATC Gene: PST_3603: C4-type zinc finger protein, DksA/TraR family	* Azotobacter vinelandii AvOP Site: position = -119 score = 5.22936 sequence = AAAATGTTATGTTATAACTATAA Gene: Avin_22970: C4-type zinc finger protein, DksA/TraR family	C4-type zinc finger protein, DksA/TraR family
yciC	Pseudomonas aeruginosa PAO1 Gene: PA5535: Putative metal chaperone, GTPase of COG0523 family	* Pseudomonas entomophila L48 Site: position = -70 score = 4.57183 sequence = AAATTGTATTGTTATAATATAAC Site: position = -65 score = 5.85945 sequence = GTATTGTTATAATATAACATTGC Gene: PSEEN5513: Putative metal chaperone, GTPase of COG0523 family	* Pseudomonas putida KT2440 Site: position = -65 score = 5.09009 sequence = GTATTGTTACCTTATAACATTAT Gene: PP5361: Putative metal chaperone, GTPase of COG0523 family	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -108 score = 5.39966 sequence = GTGTTGTTATACTATAACATCAT Gene: PSPTO5526: Putative metal chaperone, GTPase of COG0523 family	Pseudomonas fluorescens Pf-5 Gene: PFL_6173: Putative metal chaperone, GTPase of COG0523 family	Pseudomonas mendocina ymp Gene: Pmen_4536: Putative metal chaperone, GTPase of COG0523 family	Pseudomonas stutzeri A1501 Gene: PST_3604: Putative metal chaperone, GTPase of COG0523 family	Azotobacter vinelandii AvOP Gene: Avin_22980: Putative metal chaperone, GTPase of COG0523 family	Putative metal chaperone, GTPase of COG0523 family
PF08856	Pseudomonas aeruginosa PAO1 Gene: PA5534: hypothetical protein	Pseudomonas entomophila L48 Gene: PSEEN5512: hypothetical protein	Pseudomonas putida KT2440 Gene: PP5360: hypothetical protein	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO5525: hypothetical protein	Pseudomonas fluorescens Pf-5 Gene: PFL_6172: hypothetical protein	Pseudomonas mendocina ymp Gene: Pmen_4535: hypothetical protein	Pseudomonas stutzeri A1501 Gene: PST_3605: hypothetical protein	Azotobacter vinelandii AvOP Gene: Avin_22990: hypothetical protein	hypothetical protein
yciC2	Pseudomonas aeruginosa PAO1 Gene: PA5532: Putative metal chaperone, GTPase of COG0523 family	Pseudomonas entomophila L48 Gene: PSEEN5511: Putative metal chaperone, GTPase of COG0523 family	Pseudomonas putida KT2440 Gene: PP5359: Putative metal chaperone, GTPase of COG0523 family	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO5523: Putative metal chaperone, GTPase of COG0523 family	Pseudomonas fluorescens Pf-5 Gene: PFL_6171: Putative metal chaperone, GTPase of COG0523 family	Pseudomonas mendocina ymp Gene: Pmen_4533: Putative metal chaperone, GTPase of COG0523 family	Pseudomonas stutzeri A1501 Gene: PST_4179: Putative metal chaperone, GTPase of COG0523 family	Azotobacter vinelandii AvOP Gene: Avin_01740: Putative metal chaperone, GTPase of COG0523 family	Putative metal chaperone, GTPase of COG0523 family
PA4838	* Pseudomonas aeruginosa PAO1 Site: position = -122 score = 5.09085 sequence = GAAATGATATACTATAACGCTAC Gene: PA4838: membrane protein-like protein	* Pseudomonas entomophila L48 Site: position = -62 score = 5.30657 sequence = AAAAAGATATAAGATAACATTTC Gene: PSEEN2389: membrane protein-like protein	Pseudomonas putida KT2440 Gene: PP2419: membrane protein-like protein	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO2580: membrane protein-like protein	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	* Pseudomonas stutzeri A1501 Site: position = -113 score = 5.17287 sequence = CTTTTGTTATAACGTATCGCACC Gene: PST_2941: membrane protein-like protein	Azotobacter vinelandii AvOP	membrane protein-like protein
PA5537	* Pseudomonas aeruginosa PAO1 Site: position = -92 score = 5.16189 sequence = AAAACGTTATACTATAACAATTA Gene: PA5537: hypothetical protein	* Pseudomonas entomophila L48 Site: position = -67 score = 5.4493 sequence = GCAATGTTATATTATAACAATAC Gene: PSEEN5514: hypothetical protein	* Pseudomonas putida KT2440 Site: position = -72 score = 5.81849 sequence = ATAATGTTATAAGGTAACAATAC Gene: PP5362: hypothetical protein	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -56 score = 5.53758 sequence = ATGATGTTATAGTATAACAACAC Gene: PSPTO5527: hypothetical protein	* Pseudomonas fluorescens Pf-5 Site: position = -96 score = 5.37684 sequence = TTTATGTTATATTATAACAACAC Gene: PFL_6175: hypothetical protein	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501	* Azotobacter vinelandii AvOP Site: position = -44 score = 4.78292 sequence = AAAATGTTATATAGTTTCATCCT Gene: Avin_29230: hypothetical protein	hypothetical protein

CRON 2.
znuA	* Pseudomonas aeruginosa PAO1 Site: position = -48 score = 4.63904 sequence = GAGACGTTATTATATTACCCGCT Gene: PA5498: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Pseudomonas entomophila L48 Site: position = -45 score = 4.71232 sequence = GAGACGTTATTATGTTACCTGTT Gene: PSEEN0073: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Pseudomonas putida KT2440 Site: position = -45 score = 4.71232 sequence = GAGACGTTATTATGTTACCTGTT Gene: PP0120: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -46 score = 4.71232 sequence = GAGACGTTATTATGTTACCTGTT Gene: PSPTO5268: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Pseudomonas fluorescens Pf-5 Site: position = -36 score = 4.59683 sequence = GAGACGTTATTATGTTACCCGTT Gene: PFL_0079: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Pseudomonas mendocina ymp Site: position = -45 score = 4.68428 sequence = GAGACGTTATTATATTACCCGTT Gene: Pmen_4495: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Pseudomonas stutzeri A1501 Site: position = -37 score = 4.83404 sequence = GAGACGTTATTATGTACCAATTC Gene: PST_0044: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Azotobacter vinelandii AvOP Site: position = -44 score = 4.55367 sequence = GAGACGTTATTCTATTACACTTT Gene: Avin_00830: Zinc ABC transporter, periplasmic-binding protein ZnuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

CRON 3.
zur	* Pseudomonas aeruginosa PAO1 Site: position = -44 score = 3.75427 sequence = AGCGGGTAATATAATAACGTCTC Gene: PA5499: Zinc uptake regulation protein ZUR	* Pseudomonas entomophila L48 Site: position = -44 score = 4.18045 sequence = AACAGGTAACATAATAACGTCTC Gene: PSEEN0072: Zinc uptake regulation protein ZUR	* Pseudomonas putida KT2440 Site: position = -122 score = 4.18045 sequence = AACAGGTAACATAATAACGTCTC Gene: PP0119: Zinc uptake regulation protein ZUR	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -44 score = 4.18045 sequence = AACAGGTAACATAATAACGTCTC Gene: PSPTO5267: Zinc uptake regulation protein ZUR	* Pseudomonas fluorescens Pf-5 Site: position = -44 score = 3.71181 sequence = AACGGGTAACATAATAACGTCTC Gene: PFL_0078: Zinc uptake regulation protein ZUR	* Pseudomonas mendocina ymp Site: position = -44 score = 4.0303 sequence = AACGGGTAATATAATAACGTCTC Gene: Pmen_4496: Zinc uptake regulation protein ZUR	* Pseudomonas stutzeri A1501 Site: position = -44 score = 4.4828 sequence = GAATTGGTACATAATAACGTCTC Gene: PST_0043: Zinc uptake regulation protein ZUR	* Azotobacter vinelandii AvOP Site: position = -41 score = 4.53822 sequence = AAAGTGTAATAGAATAACGTCTC Gene: Avin_00840: Zinc uptake regulation protein ZUR	Zinc uptake regulation protein ZUR
znuC	Pseudomonas aeruginosa PAO1 Gene: PA5500: Zinc ABC transporter, ATP-binding protein ZnuC	Pseudomonas entomophila L48 Gene: PSEEN0071: Zinc ABC transporter, ATP-binding protein ZnuC	Pseudomonas putida KT2440 Gene: PP0118: Zinc ABC transporter, ATP-binding protein ZnuC	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO5266: Zinc ABC transporter, ATP-binding protein ZnuC	Pseudomonas fluorescens Pf-5 Gene: PFL_0077: Zinc ABC transporter, ATP-binding protein ZnuC	Pseudomonas mendocina ymp Gene: Pmen_4497: Zinc ABC transporter, ATP-binding protein ZnuC	Pseudomonas stutzeri A1501 Gene: PST_0042: Zinc ABC transporter, ATP-binding protein ZnuC	Azotobacter vinelandii AvOP Gene: Avin_00850: Zinc ABC transporter, ATP-binding protein ZnuC	Zinc ABC transporter, ATP-binding protein ZnuC
znuB	Pseudomonas aeruginosa PAO1 Gene: PA5501: Zinc ABC transporter, inner membrane permease protein ZnuB	Pseudomonas entomophila L48 Gene: PSEEN0070: Zinc ABC transporter, inner membrane permease protein ZnuB	Pseudomonas putida KT2440 Gene: PP0117: Zinc ABC transporter, inner membrane permease protein ZnuB	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO5265: Zinc ABC transporter, inner membrane permease protein ZnuB	Pseudomonas fluorescens Pf-5 Gene: PFL_0076: Zinc ABC transporter, inner membrane permease protein ZnuB	Pseudomonas mendocina ymp Gene: Pmen_4498: Zinc ABC transporter, inner membrane permease protein ZnuB	Pseudomonas stutzeri A1501 Gene: PST_0041: Zinc ABC transporter, inner membrane permease protein ZnuB	Azotobacter vinelandii AvOP Gene: Avin_00860: Zinc ABC transporter, inner membrane permease protein ZnuB	Zinc ABC transporter, inner membrane permease protein ZnuB

CRON 4.
omr	* Pseudomonas aeruginosa PAO1 Site: position = -121 score = 4.99169 sequence = AAAAAGAAATAATATAACATCCC Gene: PA0781: Zinc-regulated outer membrane receptor	* Pseudomonas entomophila L48 Site: position = -51 score = 5.11772 sequence = GATACGTTATAAAGTAACAACAA Gene: PSEEN1173: Zinc-regulated outer membrane receptor	* Pseudomonas putida KT2440 Site: position = -53 score = 5.30419 sequence = GTTATGTTATGTTGTAACACTAA Gene: PP1446: Zinc-regulated outer membrane receptor	Pseudomonas syringae pv. tomato str. DC3000	* Pseudomonas fluorescens Pf-5 Site: position = -113 score = 5.19502 sequence = GAGATGTTATATTGTATCAATCA Gene: PFL_4912: Zinc-regulated outer membrane receptor	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	Zinc-regulated outer membrane receptor

CRON 5.
amiA	* Pseudomonas aeruginosa PAO1 Site: position = -59 score = 5.60218 sequence = TGAATGTTATAATATAACGTATT Gene: PA5538: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)	Pseudomonas entomophila L48	Pseudomonas putida KT2440	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO5528: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)	* Pseudomonas fluorescens Pf-5 Site: position = -102 score = 5.55878 sequence = CACATGTTATATTATAACAATGC Gene: PFL_6176: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501	* Azotobacter vinelandii AvOP Site: position = -68 score = 4.97953 sequence = TATGTGTTATAACATAACAAAAG Gene: Avin_29220: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)	N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)

CRON 6.
zbp	* Pseudomonas aeruginosa PAO1 Site: position = -51 score = 5.71676 sequence = AATTCGTTATAACGTAACAAACT Gene: PA4063: Predicted zinc-binding protein	* Pseudomonas entomophila L48 Site: position = -50 score = 5.61594 sequence = AAGTTGTTATAACATTACCAAAT Gene: PSEEN0582: Predicted zinc-binding protein	* Pseudomonas putida KT2440 Site: position = -48 score = 5.74973 sequence = ATCTTGTTATAACATAACCCTAT Gene: PP0508: Predicted zinc-binding protein	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -54 score = 5.73284 sequence = CACTTGTTATAAGATCACATAAC Gene: PSPTO0683: Predicted zinc-binding protein	* Pseudomonas fluorescens Pf-5 Site: position = -54 score = 5.53836 sequence = CGATTGTTATAAGATCACATAAC Gene: PFL_5528: Predicted zinc-binding protein	* Pseudomonas mendocina ymp Site: position = -48 score = 5.91332 sequence = AAGTTGTTATAACGTAACGATTC Gene: Pmen_3863: Predicted zinc-binding protein	* Pseudomonas stutzeri A1501 Site: position = -41 score = 5.98356 sequence = AAGTTGTTATAACGTAACGTACC Gene: PST_0827: Predicted zinc-binding protein	* Azotobacter vinelandii AvOP Site: position = -40 score = 5.83225 sequence = AACTCGTTATAACGTAACAAAAC Gene: Avin_06650: Predicted zinc-binding protein	Predicted zinc-binding protein

CRON 7.
rpmE2	* Pseudomonas aeruginosa PAO1 Site: position = -38 score = 5.52552 sequence = AATATGTAACTATATAACATTAT Gene: PA3601: LSU ribosomal protein L31p	* Pseudomonas entomophila L48 Site: position = -43 score = 5.19852 sequence = AGTATGTTATAAAGTATCACTTT Gene: PSEEN1181: LSU ribosomal protein L31p	Pseudomonas putida KT2440	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO4183: LSU ribosomal protein L31p	* Pseudomonas fluorescens Pf-5 Site: position = -51 score = 5.28103 sequence = GATATGTTATTGTATAACGCATC Gene: PFL_4896: LSU ribosomal protein L31p	Pseudomonas mendocina ymp	* Pseudomonas stutzeri A1501 Site: position = -51 score = 5.56736 sequence = CTATTGTTATGTTATAACATCAT Gene: PST_1798: LSU ribosomal protein L31p	Azotobacter vinelandii AvOP	LSU ribosomal protein L31p
rpmJ	Pseudomonas aeruginosa PAO1 Gene: PA3600: LSU ribosomal protein L36p	Pseudomonas entomophila L48	Pseudomonas putida KT2440	Pseudomonas syringae pv. tomato str. DC3000	* Pseudomonas fluorescens Pf-5 Site: position = -47 score = 4.7526 sequence = AATATGATATGTTATTACATTAG Gene: PFL_3806: LSU ribosomal protein L36p	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	LSU ribosomal protein L36p

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Zur - Pseudomonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --