Regulon of Zur in Pseudomonas aeruginosa PAO1

Properties
Regulator type:	Transcription factor
TF locus tag:	PA5499
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Pseudomonadaceae
Statistics of regulated genes:
- Genes	17
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 3.8 Sequence: AGCGGGTAATATAATAACGTCTC Locus tag: PA5499 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: PA5500 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: PA5501 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	PA5499	zur	Zinc uptake regulation protein ZUR
	PA5500	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	PA5501	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -121 Score: 5 Sequence: AAAAAGAAATAATATAACATCCC Locus tag: PA0781 Name: omr Funciton: Zinc-regulated outer membrane receptor
	PA0781	omr	Zinc-regulated outer membrane receptor
Position: -38 Score: 5.5 Sequence: AATATGTAACTATATAACATTAT Locus tag: PA3601 Name: rpmE2 Funciton: LSU ribosomal protein L31p Locus tag: PA3600 Name: rpmJ Funciton: LSU ribosomal protein L36p
	PA3601	rpmE2	LSU ribosomal protein L31p
	PA3600	rpmJ	LSU ribosomal protein L36p
Position: -43 Score: 5.5 Sequence: TAATTGTTATAGTATAACGTTTT Locus tag: PA5536 Name: dksA2 Funciton: C4-type zinc finger protein, DksA/TraR family Locus tag: PA5535 Name: yciC Funciton: Putative metal chaperone, GTPase of COG0523 family Locus tag: PA5534 Name: PF08856 Funciton: hypothetical protein
	PA5536	dksA2	C4-type zinc finger protein, DksA/TraR family
	PA5535	yciC	Putative metal chaperone, GTPase of COG0523 family
	PA5534	PF08856	hypothetical protein
Position: -122 Score: 5.1 Sequence: GAAATGATATACTATAACGCTAC Locus tag: PA4838 Name: PA4838 Funciton: membrane protein-like protein
	PA4838	PA4838	membrane protein-like protein
Position: -92 Score: 5.2 Sequence: AAAACGTTATACTATAACAATTA Locus tag: PA5537 Name: PA5537 Funciton: hypothetical protein
	PA5537	PA5537	hypothetical protein
Position: -63 Score: 5.5 Sequence: AATACGTTATATTATAACATTCA Locus tag: PA5539 Name: folE2 Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2 Locus tag: PA5540 Name: can Funciton: Carbonic anhydrase (EC 4.2.1.1) Locus tag: PA5541 Name: pyrC2 Funciton: Dihydroorotase (EC 3.5.2.3)
	PA5539	folE2	GTP cyclohydrolase I (EC 3.5.4.16) type 2
	PA5540	can	Carbonic anhydrase (EC 4.2.1.1)
	PA5541	pyrC2	Dihydroorotase (EC 3.5.2.3)
Position: -59 Score: 5.6 Sequence: TGAATGTTATAATATAACGTATT Locus tag: PA5538 Name: amiA Funciton: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)
	PA5538	amiA	N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)
Position: -51 Score: 5.7 Sequence: AATTCGTTATAACGTAACAAACT Locus tag: PA4063 Name: zbp Funciton: Predicted zinc-binding protein
	PA4063	zbp	Predicted zinc-binding protein
Position: -48 Score: 4.6 Sequence: GAGACGTTATTATATTACCCGCT Locus tag: PA5498 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	PA5498	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Pseudomonas aeruginosa PAO1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --