Regulon of Zur in Pseudomonas stutzeri A1501

Properties
Regulator type:	Transcription factor
TF locus tag:	PST_0043
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Pseudomonadaceae
Statistics of regulated genes:
- Genes	10
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -113 Score: 5.2 Sequence: CTTTTGTTATAACGTATCGCACC Locus tag: PST_2941 Name: PA4838 Funciton: membrane protein-like protein
	PST_2941	PA4838	membrane protein-like protein
Position: -90 Score: 4.7 Sequence: TAAACGTTATGTTATAACTAATC Locus tag: PST_3603 Name: dksA2 Funciton: C4-type zinc finger protein, DksA/TraR family Locus tag: PST_3604 Name: yciC Funciton: Putative metal chaperone, GTPase of COG0523 family Locus tag: PST_3605 Name: PF08856 Funciton: hypothetical protein
	PST_3603	dksA2	C4-type zinc finger protein, DksA/TraR family
	PST_3604	yciC	Putative metal chaperone, GTPase of COG0523 family
	PST_3605	PF08856	hypothetical protein
Position: -41 Score: 6 Sequence: AAGTTGTTATAACGTAACGTACC Locus tag: PST_0827 Name: zbp Funciton: Predicted zinc-binding protein
	PST_0827	zbp	Predicted zinc-binding protein
Position: -51 Score: 5.6 Sequence: CTATTGTTATGTTATAACATCAT Locus tag: PST_1798 Name: rpmE2 Funciton: LSU ribosomal protein L31p
	PST_1798	rpmE2	LSU ribosomal protein L31p
Position: -44 Score: 4.5 Sequence: GAATTGGTACATAATAACGTCTC Locus tag: PST_0043 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: PST_0042 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: PST_0041 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	PST_0043	zur	Zinc uptake regulation protein ZUR
	PST_0042	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	PST_0041	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -37 Score: 4.8 Sequence: GAGACGTTATTATGTACCAATTC Locus tag: PST_0044 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	PST_0044	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD