Regulon of Zur in Pseudomonas syringae pv. tomato str. DC3000

Properties
Regulator type:	Transcription factor
TF locus tag:	PSPTO5267
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Pseudomonadaceae
Statistics of regulated genes:
- Genes	11
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -108 Score: 5.4 Sequence: GTGTTGTTATACTATAACATCAT Locus tag: PSPTO5526 Name: yciC Funciton: Putative metal chaperone, GTPase of COG0523 family Locus tag: PSPTO5525 Name: PF08856 Funciton: hypothetical protein
	PSPTO5526	yciC	Putative metal chaperone, GTPase of COG0523 family
	PSPTO5525	PF08856	hypothetical protein
Position: -108 Score: 5.4 Sequence: ATGATGTTATAGTGTAACGAATT Locus tag: PSPTO2578 Name: folE2 Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2 Locus tag: PSPTO2579 Name: can Funciton: Carbonic anhydrase (EC 4.2.1.1) Locus tag: PSPTO2580 Name: PA4838 Funciton: membrane protein-like protein
	PSPTO2578	folE2	GTP cyclohydrolase I (EC 3.5.4.16) type 2
	PSPTO2579	can	Carbonic anhydrase (EC 4.2.1.1)
	PSPTO2580	PA4838	membrane protein-like protein
Position: -56 Score: 5.5 Sequence: ATGATGTTATAGTATAACAACAC Locus tag: PSPTO5527 Name: PA5537 Funciton: hypothetical protein
	PSPTO5527	PA5537	hypothetical protein
Position: -54 Score: 5.7 Sequence: CACTTGTTATAAGATCACATAAC Locus tag: PSPTO0683 Name: zbp Funciton: Predicted zinc-binding protein
	PSPTO0683	zbp	Predicted zinc-binding protein
Position: -44 Score: 4.2 Sequence: AACAGGTAACATAATAACGTCTC Locus tag: PSPTO5267 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: PSPTO5266 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: PSPTO5265 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	PSPTO5267	zur	Zinc uptake regulation protein ZUR
	PSPTO5266	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	PSPTO5265	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -46 Score: 4.7 Sequence: GAGACGTTATTATGTTACCTGTT Locus tag: PSPTO5268 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	PSPTO5268	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD