Regulon of Zur in Pseudomonas putida KT2440

Properties
Regulator type:	Transcription factor
TF locus tag:	PP0119
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Pseudomonadaceae
Statistics of regulated genes:
- Genes	15
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: 5.1 Sequence: TAAGTGTTATAACATAACATCTA Locus tag: PP3320 Name: hisI2 Funciton: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
	PP3320	hisI2	Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
Position: -3 Score: 5.3 Sequence: TAGATGTTATGTTATAACACTTA Locus tag: PP3321 Name: PP3321 Funciton: hypothetical protein Locus tag: PP3322 Name: hemB2 Funciton: Porphobilinogen synthase (EC 4.2.1.24) Locus tag: PP3323 Name: yciC3 Funciton: Putative metal chaperone, GTPase of COG0523 family Locus tag: PP3324 Name: folE2 Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
	PP3321	PP3321	hypothetical protein
	PP3322	hemB2	Porphobilinogen synthase (EC 4.2.1.24)
	PP3323	yciC3	Putative metal chaperone, GTPase of COG0523 family
	PP3324	folE2	GTP cyclohydrolase I (EC 3.5.4.16) type 2
Position: -53 Score: 5.3 Sequence: GTTATGTTATGTTGTAACACTAA Locus tag: PP1446 Name: omr Funciton: Zinc-regulated outer membrane receptor
	PP1446	omr	Zinc-regulated outer membrane receptor
Position: -72 Score: 5.8 Sequence: ATAATGTTATAAGGTAACAATAC Locus tag: PP5362 Name: PA5537 Funciton: hypothetical protein
	PP5362	PA5537	hypothetical protein
Position: -65 Score: 5.1 Sequence: GTATTGTTACCTTATAACATTAT Locus tag: PP5361 Name: yciC Funciton: Putative metal chaperone, GTPase of COG0523 family Locus tag: PP5360 Name: PF08856 Funciton: hypothetical protein Locus tag: PP5359 Name: yciC2 Funciton: Putative metal chaperone, GTPase of COG0523 family
	PP5361	yciC	Putative metal chaperone, GTPase of COG0523 family
	PP5360	PF08856	hypothetical protein
	PP5359	yciC2	Putative metal chaperone, GTPase of COG0523 family
Position: -48 Score: 5.7 Sequence: ATCTTGTTATAACATAACCCTAT Locus tag: PP0508 Name: zbp Funciton: Predicted zinc-binding protein
	PP0508	zbp	Predicted zinc-binding protein
Position: -122 Score: 4.2 Sequence: AACAGGTAACATAATAACGTCTC Locus tag: PP0119 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: PP0118 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: PP0117 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	PP0119	zur	Zinc uptake regulation protein ZUR
	PP0118	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	PP0117	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -45 Score: 4.7 Sequence: GAGACGTTATTATGTTACCTGTT Locus tag: PP0120 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	PP0120	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Pseudomonas putida KT2440

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --