Regulon of Zur in Pseudomonas mendocina ymp

Properties
Regulator type:	Transcription factor
TF locus tag:	Pmen_4496
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Pseudomonadaceae
Statistics of regulated genes:
- Genes	12
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -50 Score: 5.9 Sequence: CAATTGTTATAACATAACATTTA Locus tag: Pmen_4538 Name: folE2 Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2 Locus tag: Pmen_4539 Name: hisI2 Funciton: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) Locus tag: Pmen_4540 Name: DUF37 Funciton: Protein of unknown function DUF37 Locus tag: Pmen_4541 Name: pyrC2 Funciton: Dihydroorotase (EC 3.5.2.3)
	Pmen_4538	folE2	GTP cyclohydrolase I (EC 3.5.4.16) type 2
	Pmen_4539	hisI2	Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
	Pmen_4540	DUF37	Protein of unknown function DUF37
	Pmen_4541	pyrC2	Dihydroorotase (EC 3.5.2.3)
Position: -44 Score: 5.1 Sequence: TAAATGTTATGTTATAACAATTG Locus tag: Pmen_4537 Name: dksA2 Funciton: C4-type zinc finger protein, DksA/TraR family Locus tag: Pmen_4536 Name: yciC Funciton: Putative metal chaperone, GTPase of COG0523 family Locus tag: Pmen_4535 Name: PF08856 Funciton: hypothetical protein
	Pmen_4537	dksA2	C4-type zinc finger protein, DksA/TraR family
	Pmen_4536	yciC	Putative metal chaperone, GTPase of COG0523 family
	Pmen_4535	PF08856	hypothetical protein
Position: -48 Score: 5.9 Sequence: AAGTTGTTATAACGTAACGATTC Locus tag: Pmen_3863 Name: zbp Funciton: Predicted zinc-binding protein
	Pmen_3863	zbp	Predicted zinc-binding protein
Position: -44 Score: 4 Sequence: AACGGGTAATATAATAACGTCTC Locus tag: Pmen_4496 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: Pmen_4497 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Pmen_4498 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	Pmen_4496	zur	Zinc uptake regulation protein ZUR
	Pmen_4497	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Pmen_4498	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -45 Score: 4.7 Sequence: GAGACGTTATTATATTACCCGTT Locus tag: Pmen_4495 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	Pmen_4495	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD