Regulon of Zur in Pseudomonas entomophila L48

Properties
Regulator type:	Transcription factor
TF locus tag:	PSEEN0072
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Pseudomonadaceae
Statistics of regulated genes:
- Genes	16
- Operons	9
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 5.2 Sequence: AGTATGTTATAAAGTATCACTTT Locus tag: PSEEN1181 Name: rpmE2 Funciton: LSU ribosomal protein L31p
	PSEEN1181	rpmE2	LSU ribosomal protein L31p
Position: -51 Score: 5.1 Sequence: GATACGTTATAAAGTAACAACAA Locus tag: PSEEN1173 Name: omr Funciton: Zinc-regulated outer membrane receptor
	PSEEN1173	omr	Zinc-regulated outer membrane receptor
Position: -70 Score: 4.6 Sequence: AAATTGTATTGTTATAATATAAC Position: -65 Score: 5.9 Sequence: GTATTGTTATAATATAACATTGC Locus tag: PSEEN5513 Name: yciC Funciton: Putative metal chaperone, GTPase of COG0523 family Locus tag: PSEEN5512 Name: PF08856 Funciton: hypothetical protein Locus tag: PSEEN5511 Name: yciC2 Funciton: Putative metal chaperone, GTPase of COG0523 family
	PSEEN5513	yciC	Putative metal chaperone, GTPase of COG0523 family
	PSEEN5512	PF08856	hypothetical protein
	PSEEN5511	yciC2	Putative metal chaperone, GTPase of COG0523 family
Position: -52 Score: 5.4 Sequence: TAAATGTTATAATATAACAATTG Locus tag: PSEEN3120 Name: can Funciton: Carbonic anhydrase (EC 4.2.1.1) Locus tag: PSEEN3119 Name: pyrC2 Funciton: Dihydroorotase (EC 3.5.2.3) Locus tag: PSEEN3118 Name: dksA2 Funciton: C4-type zinc finger protein, DksA/TraR family
	PSEEN3120	can	Carbonic anhydrase (EC 4.2.1.1)
	PSEEN3119	pyrC2	Dihydroorotase (EC 3.5.2.3)
	PSEEN3118	dksA2	C4-type zinc finger protein, DksA/TraR family
Position: -62 Score: 5.3 Sequence: AAAAAGATATAAGATAACATTTC Locus tag: PSEEN2389 Name: PA4838 Funciton: membrane protein-like protein
	PSEEN2389	PA4838	membrane protein-like protein
Position: -67 Score: 5.4 Sequence: GCAATGTTATATTATAACAATAC Locus tag: PSEEN5514 Name: PA5537 Funciton: hypothetical protein Locus tag: PSEEN5515 Name: folE2 Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
	PSEEN5514	PA5537	hypothetical protein
	PSEEN5515	folE2	GTP cyclohydrolase I (EC 3.5.4.16) type 2
Position: -50 Score: 5.6 Sequence: AAGTTGTTATAACATTACCAAAT Locus tag: PSEEN0582 Name: zbp Funciton: Predicted zinc-binding protein
	PSEEN0582	zbp	Predicted zinc-binding protein
Position: -44 Score: 4.2 Sequence: AACAGGTAACATAATAACGTCTC Locus tag: PSEEN0072 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: PSEEN0071 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: PSEEN0070 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	PSEEN0072	zur	Zinc uptake regulation protein ZUR
	PSEEN0071	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	PSEEN0070	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -45 Score: 4.7 Sequence: GAGACGTTATTATGTTACCTGTT Locus tag: PSEEN0073 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	PSEEN0073	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Pseudomonas entomophila L48

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --