Regulon of Zur in Pseudomonas fluorescens Pf-5

Properties
Regulator type:	Transcription factor
TF locus tag:	PFL_0078
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Pseudomonadaceae
Statistics of regulated genes:
- Genes	21
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -113 Score: 5.2 Sequence: GAGATGTTATATTGTATCAATCA Locus tag: PFL_4912 Name: omr Funciton: Zinc-regulated outer membrane receptor
	PFL_4912	omr	Zinc-regulated outer membrane receptor
Position: -48 Score: 5.9 Sequence: GTGTTGTTATAATATAACATAAA Locus tag: PFL_6174 Name: dksA2 Funciton: C4-type zinc finger protein, DksA/TraR family Locus tag: PFL_6173 Name: yciC Funciton: Putative metal chaperone, GTPase of COG0523 family Locus tag: PFL_6172 Name: PF08856 Funciton: hypothetical protein Locus tag: PFL_6171 Name: yciC2 Funciton: Putative metal chaperone, GTPase of COG0523 family
	PFL_6174	dksA2	C4-type zinc finger protein, DksA/TraR family
	PFL_6173	yciC	Putative metal chaperone, GTPase of COG0523 family
	PFL_6172	PF08856	hypothetical protein
	PFL_6171	yciC2	Putative metal chaperone, GTPase of COG0523 family
Position: -96 Score: 5.4 Sequence: TTTATGTTATATTATAACAACAC Locus tag: PFL_6175 Name: PA5537 Funciton: hypothetical protein
	PFL_6175	PA5537	hypothetical protein
Position: -50 Score: 5.1 Sequence: GCATTGTTATAATATAACATGTG Locus tag: PFL_6177 Name: folE2 Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2 Locus tag: PFL_6178 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: PFL_6179 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: PFL_6180 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: PFL_6181 Name: hisI2 Funciton: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) Locus tag: PFL_6182 Name: can Funciton: Carbonic anhydrase (EC 4.2.1.1) Locus tag: PFL_6183 Name: pyrC2 Funciton: Dihydroorotase (EC 3.5.2.3)
	PFL_6177	folE2	GTP cyclohydrolase I (EC 3.5.4.16) type 2
	PFL_6178	znuC2	Zinc ABC transporter, ATP-binding protein ZnuC
	PFL_6179	znuB2	Zinc ABC transporter, inner membrane permease protein ZnuB
	PFL_6180	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA
	PFL_6181	hisI2	Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
	PFL_6182	can	Carbonic anhydrase (EC 4.2.1.1)
	PFL_6183	pyrC2	Dihydroorotase (EC 3.5.2.3)
Position: -54 Score: 5.5 Sequence: CGATTGTTATAAGATCACATAAC Locus tag: PFL_5528 Name: zbp Funciton: Predicted zinc-binding protein
	PFL_5528	zbp	Predicted zinc-binding protein
Position: -102 Score: 5.6 Sequence: CACATGTTATATTATAACAATGC Locus tag: PFL_6176 Name: amiA Funciton: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)
	PFL_6176	amiA	N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)
Position: -51 Score: 5.3 Sequence: GATATGTTATTGTATAACGCATC Locus tag: PFL_4896 Name: rpmE2 Funciton: LSU ribosomal protein L31p
	PFL_4896	rpmE2	LSU ribosomal protein L31p
Position: -44 Score: 3.7 Sequence: AACGGGTAACATAATAACGTCTC Locus tag: PFL_0078 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: PFL_0077 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: PFL_0076 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	PFL_0078	zur	Zinc uptake regulation protein ZUR
	PFL_0077	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	PFL_0076	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -36 Score: 4.6 Sequence: GAGACGTTATTATGTTACCCGTT Locus tag: PFL_0079 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	PFL_0079	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -47 Score: 4.8 Sequence: AATATGATATGTTATTACATTAG Locus tag: PFL_3806 Name: rpmJ Funciton: LSU ribosomal protein L36p
	PFL_3806	rpmJ	LSU ribosomal protein L36p

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Pseudomonas fluorescens Pf-5

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --