Regulog Zur - Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Pseudoalteromonas atlantica T6c | 14 | 7 |
| Alteromonas macleodii 'Deep ecotype' | 7 | 5 |
| Glaciecola sp. HTCC2999 | 2 | 2 |
| Colwellia psychrerythraea 34H | 4 | 4 |
| Alteromonadales bacterium TW-7 | 11 | 6 |
| Pseudoalteromonas haloplanktis TAC125 | 3 | 3 |
| Pseudoalteromonas tunicata D2 | 6 | 4 |
| Idiomarina baltica OS145 | 2 | 2 |
| Idiomarina loihiensis L2TR | 3 | 3 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| COG4525 |
*
Pseudoalteromonas atlantica T6c Site: position = -32 score = 6.18822 sequence = ATTATGTTATATTATAACGATAC Site: position = -62 score = 5.7517 sequence = TTATCGTTATAATATAACATAGC Gene: Patl_3773: ABC transporter ATP-binding protein |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -50 score = 5.21201 sequence = GTAATAATATAACATTACAACAC Site: position = -55 score = 6.05488 sequence = TTATGGTAATAATATAACATTAC Gene: MADE_01807: ABC transporter ATP-binding protein |
|
|
*
Alteromonadales bacterium TW-7 Site: position = -56 score = 5.96608 sequence = GAGTTGTTATAGTATAACATCCC Gene: ATW7_12973: ABC transporter ATP-binding protein |
|
|
|
|
ABC transporter ATP-binding protein |
| COG1277 |
Gene: Patl_3774: hypothetical protein |
Gene: MADE_01806: hypothetical protein |
|
|
Gene: ATW7_12968: hypothetical protein |
|
|
|
|
hypothetical protein |
| PF12040 |
Gene: Patl_3775: Gll1302 protein |
Gene: MADE_01805: Gll1302 protein |
|
|
Gene: ATW7_12963: Gll1302 protein |
|
|
|
|
Gll1302 protein |
| foxA |
Gene: Patl_3776: TonB-dependent siderophore receptor |
|
|
|
Gene: ATW7_12958: TonB-dependent siderophore receptor |
Gene: PSHAa1584: TonB-dependent siderophore receptor |
|
|
|
TonB-dependent siderophore receptor |
| CRON 2. | ||||||||||
| omr |
*2
Pseudoalteromonas atlantica T6c Site: position = -55 score = 6.30826 sequence = TTGGTGTTATATTATAACATCAC Gene: Patl_3627: Zinc-regulated outer membrane receptor Gene: Patl_2604: Zinc-regulated outer membrane receptor |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -52 score = 5.43302 sequence = AAAATGTTATAACATCACTAAAT Gene: MADE_03676: Zinc-regulated outer membrane receptor |
|
|
*
Alteromonadales bacterium TW-7 Site: position = -85 score = 6.04188 sequence = TAAAAGTTATAGTATAACATTGT Site: position = -47 score = 4.99413 sequence = GAACTGTTATATTATATCACAAC Gene: ATW7_07102: Zinc-regulated outer membrane receptor |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -48 score = 5.25736 sequence = GTAGTGTTATATTATATCACAAC Site: position = -86 score = 6.28484 sequence = ATAAGGTTATACTATAACATCAT Gene: PSHAa1415: Zinc-regulated outer membrane receptor |
*
Pseudoalteromonas tunicata D2 Site: position = -83 score = 5.62876 sequence = CAAATGTTATAGCATCACAGTTG Site: position = -43 score = 5.04816 sequence = GTAATGTTACACTATCTCAATTG Gene: PTD2_19912: Zinc-regulated outer membrane receptor |
*
Idiomarina baltica OS145 Site: position = -67 score = 6.52485 sequence = GTAATGTTATATTATCACATTAA Gene: OS145_12066: Zinc-regulated outer membrane receptor |
*
Idiomarina loihiensis L2TR Site: position = -64 score = 6.2914 sequence = GTAATGTTATATTATTACAATAA Gene: IL1028: Zinc-regulated outer membrane receptor |
Zinc-regulated outer membrane receptor |
| CRON 3. | ||||||||||
| omr2 |
|
*
Alteromonas macleodii 'Deep ecotype' Site: position = -25 score = 5.81786 sequence = AAAATGAGATAACATAACATCAC Gene: MADE_01528: Zinc-regulated outer membrane receptor |
|
|
|
|
|
|
*
Idiomarina loihiensis L2TR Site: position = -56 score = 6.79845 sequence = TTATTGTTATAATATAACATTAC Gene: IL2588: Zinc-regulated outer membrane receptor |
Zinc-regulated outer membrane receptor |
| CRON 4. | ||||||||||
| PF11736 |
*
Pseudoalteromonas atlantica T6c Site: position = -67 score = 5.62825 sequence = CTATTGATATGTTATAACATTTA Gene: Patl_0305: lipoprotein, putative |
|
Gene: GHTCC_010100007807: lipoprotein, putative |
*
Colwellia psychrerythraea 34H Site: position = -60 score = 5.87669 sequence = TTTATGTTATGTTATAACATTGA Gene: CPS_1814: lipoprotein, putative |
|
|
|
|
|
lipoprotein, putative |
| CRON 5. | ||||||||||
| PF05787 |
*
Pseudoalteromonas atlantica T6c Site: position = -58 score = 5.84936 sequence = ATTATGTGATAACATAACATTTT Gene: Patl_0331: hypothetical protein |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -87 score = 5.50597 sequence = ATGTTGTTATAGTGTAACAATAT Gene: MADE_00705: hypothetical protein |
|
|
|
|
|
|
|
hypothetical protein |
| CRON 6. | ||||||||||
| zbp |
*
Pseudoalteromonas atlantica T6c Site: position = -204 score = 5.37397 sequence = GTGATGTTATATTGTATCATTTA Site: position = -175 score = 4.86742 sequence = GTTATGTTATATTGTAACCAATT Gene: Patl_0296: Predicted zinc-binding protein |
|
Gene: GHTCC_010100007797: Predicted zinc-binding protein |
Gene: CPS_1817: Predicted zinc-binding protein |
|
|
|
|
|
Predicted zinc-binding protein |
| zur2 |
Gene: Patl_0297: Zinc uptake regulation protein paralog |
|
|
|
*
Alteromonadales bacterium TW-7 Site: position = -146 score = 5.09497 sequence = TAGATGTTATATTGTATCAATTG Site: position = -118 score = 5.88608 sequence = TATATGTTATATTATATCAATAG Gene: ATW7_16049: Zinc uptake regulation protein paralog |
|
|
|
|
Zinc uptake regulation protein paralog |
| Patl_0298 |
Gene: Patl_0298: hypothetical protein |
|
|
Gene: CPS_1818: hypothetical protein |
Gene: ATW7_16044: hypothetical protein |
|
|
|
|
hypothetical protein |
| yciC |
Gene: Patl_0299: Putative metal chaperone, GTPase of COG0523 family |
|
|
Gene: CPS_1815: Putative metal chaperone, GTPase of COG0523 family |
*
Alteromonadales bacterium TW-7 Site: position = -51 score = 6.06735 sequence = ATATTGATATAATATAACATATC Gene: ATW7_09166: Putative metal chaperone, GTPase of COG0523 family |
|
|
|
|
Putative metal chaperone, GTPase of COG0523 family |
| PF08856 |
Gene: Patl_0300: hypothetical protein |
|
|
Gene: CPS_1816: hypothetical protein |
Gene: ATW7_09171: hypothetical protein |
|
*
Pseudoalteromonas tunicata D2 Site: position = -39 score = 5.77924 sequence = CTTTTGATATATTATCACATAAC Gene: PTD2_00701: hypothetical protein |
|
|
hypothetical protein |
| CRON 7. | ||||||||||
| ribA |
|
|
|
Gene: CPS_1824: GTP cyclohydrolase II (EC 3.5.4.25) |
*
Alteromonadales bacterium TW-7 Site: position = -59 score = 5.23254 sequence = CTTTTGTGATACTATCACTTTAT Gene: ATW7_11681: GTP cyclohydrolase II (EC 3.5.4.25) |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -59 score = 5.40053 sequence = CTTTTGTGATAATATCACTTCAT Gene: PSHAa0529: GTP cyclohydrolase II (EC 3.5.4.25) |
*2
Pseudoalteromonas tunicata D2 Gene: PTD2_14452: GTP cyclohydrolase II (EC 3.5.4.25) Site: position = -47 score = 6.04541 sequence = CTTTTGTTATATTATCACAATAT Gene: PTD2_14447: GTP cyclohydrolase II (EC 3.5.4.25) |
|
|
GTP cyclohydrolase II (EC 3.5.4.25) |
| CRON 8. | ||||||||||
| PF03203 |
*
Pseudoalteromonas atlantica T6c Site: position = -45 score = 6.16751 sequence = TTGATGTTATATTATAACGTTCA Gene: Patl_3486: MerC-like membrane protein |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -163 score = 5.41246 sequence = AGTCTGTTATAATATAACGTCTC Gene: MADE_00546: MerC-like membrane protein |
*
Glaciecola sp. HTCC2999 Site: position = -49 score = 6.27493 sequence = TTTATGTTATACTATAACATCGA Gene: GHTCC_010100002164: MerC-like membrane protein |
*
Colwellia psychrerythraea 34H Site: position = -94 score = 5.96206 sequence = CTAATGTTATATTATATCAATTG Gene: CPS_0396: MerC-like membrane protein |
|
|
|
*
Idiomarina baltica OS145 Site: position = -43 score = 5.73465 sequence = CGTATGTTATAATATAACAGGCT Gene: OS145_08107: MerC-like membrane protein |
*
Idiomarina loihiensis L2TR Site: position = -50 score = 5.7462 sequence = CGTATGTTATAATATTACAGCTT Gene: IL2274: MerC-like membrane protein |
MerC-like membrane protein |
| CRON 9. | ||||||||||
| PF11751 |
|
|
|
*
Colwellia psychrerythraea 34H Site: position = -191 score = 5.29884 sequence = TACTTGTTATAGTATAACACTTA Gene: CPS_4490: Putative exported protein |
|
|
|
|
|
Putative exported protein |
| CRON 10. | ||||||||||
| omr1 |
*
Pseudoalteromonas atlantica T6c Site: position = -65 score = 5.45275 sequence = AATTGGTTACAATATAACATAAC Site: position = -36 score = 6.16436 sequence = TAAATGATACAATATAACATCAC Gene: Patl_0295: Zinc-regulated outer membrane receptor |
|
*
Glaciecola sp. HTCC2999 Site: position = -53 score = 6.25882 sequence = GTAATGTGATATTATAACATTTC Gene: GHTCC_010100001624: Zinc-regulated outer membrane receptor |
*
Colwellia psychrerythraea 34H Site: position = -194 score = 6.44099 sequence = ATAATGTGATAATATAACATTAT Site: position = -169 score = 5.4576 sequence = AAATTGTTACATTATCACATTGG Gene: CPS_1902: Zinc-regulated outer membrane receptor |
*
Alteromonadales bacterium TW-7 Site: position = -36 score = 5.70791 sequence = CAATTGATACAATATAACATCTA Site: position = -64 score = 6.04821 sequence = CTATTGATATAATATAACATATA Gene: ATW7_16054: Zinc-regulated outer membrane receptor |
|
|
|
|
Zinc-regulated outer membrane receptor |
| CRON 11. | ||||||||||
| rpmE2 |
|
|
|
|
|
|
*
Pseudoalteromonas tunicata D2 Site: position = -34 score = 5.68876 sequence = GTTATGATATACTATCACATAAT Gene: PTD2_02796: LSU ribosomal protein L31p |
|
|
LSU ribosomal protein L31p |
| rpmJ |
|
|
|
|
|
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -73 score = 5.64342 sequence = AAAATGATACAATATCACATAAC Gene: PSHAb0382: LSU ribosomal protein L36p |
Gene: PTD2_02801: LSU ribosomal protein L36p |
|
|
LSU ribosomal protein L36p |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |