Regulog Zur - Alteromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Pseudoalteromonas atlantica T6c	14	7
Alteromonas macleodii 'Deep ecotype'	7	5
Glaciecola sp. HTCC2999	2	2
Colwellia psychrerythraea 34H	4	4
Alteromonadales bacterium TW-7	11	6
Pseudoalteromonas haloplanktis TAC125	3	3
Pseudoalteromonas tunicata D2	6	4
Idiomarina baltica OS145	2	2
Idiomarina loihiensis L2TR	3	3

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
COG4525	* Pseudoalteromonas atlantica T6c Site: position = -32 score = 6.18822 sequence = ATTATGTTATATTATAACGATAC Site: position = -62 score = 5.7517 sequence = TTATCGTTATAATATAACATAGC Gene: Patl_3773: ABC transporter ATP-binding protein	* Alteromonas macleodii 'Deep ecotype' Site: position = -50 score = 5.21201 sequence = GTAATAATATAACATTACAACAC Site: position = -55 score = 6.05488 sequence = TTATGGTAATAATATAACATTAC Gene: MADE_01807: ABC transporter ATP-binding protein	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H	* Alteromonadales bacterium TW-7 Site: position = -56 score = 5.96608 sequence = GAGTTGTTATAGTATAACATCCC Gene: ATW7_12973: ABC transporter ATP-binding protein	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	ABC transporter ATP-binding protein
COG1277	Pseudoalteromonas atlantica T6c Gene: Patl_3774: hypothetical protein	Alteromonas macleodii 'Deep ecotype' Gene: MADE_01806: hypothetical protein	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H	Alteromonadales bacterium TW-7 Gene: ATW7_12968: hypothetical protein	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	hypothetical protein
PF12040	Pseudoalteromonas atlantica T6c Gene: Patl_3775: Gll1302 protein	Alteromonas macleodii 'Deep ecotype' Gene: MADE_01805: Gll1302 protein	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H	Alteromonadales bacterium TW-7 Gene: ATW7_12963: Gll1302 protein	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	Gll1302 protein
foxA	Pseudoalteromonas atlantica T6c Gene: Patl_3776: TonB-dependent siderophore receptor	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H	Alteromonadales bacterium TW-7 Gene: ATW7_12958: TonB-dependent siderophore receptor	Pseudoalteromonas haloplanktis TAC125 Gene: PSHAa1584: TonB-dependent siderophore receptor	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	TonB-dependent siderophore receptor

CRON 2.
omr	2 Pseudoalteromonas atlantica T6c* Site: position = -55 score = 6.30826 sequence = TTGGTGTTATATTATAACATCAC Gene: Patl_3627: Zinc-regulated outer membrane receptor Gene: Patl_2604: Zinc-regulated outer membrane receptor	* Alteromonas macleodii 'Deep ecotype' Site: position = -52 score = 5.43302 sequence = AAAATGTTATAACATCACTAAAT Gene: MADE_03676: Zinc-regulated outer membrane receptor	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H	* Alteromonadales bacterium TW-7 Site: position = -85 score = 6.04188 sequence = TAAAAGTTATAGTATAACATTGT Site: position = -47 score = 4.99413 sequence = GAACTGTTATATTATATCACAAC Gene: ATW7_07102: Zinc-regulated outer membrane receptor	* Pseudoalteromonas haloplanktis TAC125 Site: position = -48 score = 5.25736 sequence = GTAGTGTTATATTATATCACAAC Site: position = -86 score = 6.28484 sequence = ATAAGGTTATACTATAACATCAT Gene: PSHAa1415: Zinc-regulated outer membrane receptor	* Pseudoalteromonas tunicata D2 Site: position = -83 score = 5.62876 sequence = CAAATGTTATAGCATCACAGTTG Site: position = -43 score = 5.04816 sequence = GTAATGTTACACTATCTCAATTG Gene: PTD2_19912: Zinc-regulated outer membrane receptor	* Idiomarina baltica OS145 Site: position = -67 score = 6.52485 sequence = GTAATGTTATATTATCACATTAA Gene: OS145_12066: Zinc-regulated outer membrane receptor	* Idiomarina loihiensis L2TR Site: position = -64 score = 6.2914 sequence = GTAATGTTATATTATTACAATAA Gene: IL1028: Zinc-regulated outer membrane receptor	Zinc-regulated outer membrane receptor

CRON 3.
omr2	Pseudoalteromonas atlantica T6c	* Alteromonas macleodii 'Deep ecotype' Site: position = -25 score = 5.81786 sequence = AAAATGAGATAACATAACATCAC Gene: MADE_01528: Zinc-regulated outer membrane receptor	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H	Alteromonadales bacterium TW-7	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145	* Idiomarina loihiensis L2TR Site: position = -56 score = 6.79845 sequence = TTATTGTTATAATATAACATTAC Gene: IL2588: Zinc-regulated outer membrane receptor	Zinc-regulated outer membrane receptor

CRON 4.
PF11736	* Pseudoalteromonas atlantica T6c Site: position = -67 score = 5.62825 sequence = CTATTGATATGTTATAACATTTA Gene: Patl_0305: lipoprotein, putative	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999 Gene: GHTCC_010100007807: lipoprotein, putative	* Colwellia psychrerythraea 34H Site: position = -60 score = 5.87669 sequence = TTTATGTTATGTTATAACATTGA Gene: CPS_1814: lipoprotein, putative	Alteromonadales bacterium TW-7	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	lipoprotein, putative

CRON 5.
PF05787	* Pseudoalteromonas atlantica T6c Site: position = -58 score = 5.84936 sequence = ATTATGTGATAACATAACATTTT Gene: Patl_0331: hypothetical protein	* Alteromonas macleodii 'Deep ecotype' Site: position = -87 score = 5.50597 sequence = ATGTTGTTATAGTGTAACAATAT Gene: MADE_00705: hypothetical protein	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H	Alteromonadales bacterium TW-7	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	hypothetical protein

CRON 6.
zbp	* Pseudoalteromonas atlantica T6c Site: position = -204 score = 5.37397 sequence = GTGATGTTATATTGTATCATTTA Site: position = -175 score = 4.86742 sequence = GTTATGTTATATTGTAACCAATT Gene: Patl_0296: Predicted zinc-binding protein	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999 Gene: GHTCC_010100007797: Predicted zinc-binding protein	Colwellia psychrerythraea 34H Gene: CPS_1817: Predicted zinc-binding protein	Alteromonadales bacterium TW-7	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	Predicted zinc-binding protein
zur2	Pseudoalteromonas atlantica T6c Gene: Patl_0297: Zinc uptake regulation protein paralog	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H	* Alteromonadales bacterium TW-7 Site: position = -146 score = 5.09497 sequence = TAGATGTTATATTGTATCAATTG Site: position = -118 score = 5.88608 sequence = TATATGTTATATTATATCAATAG Gene: ATW7_16049: Zinc uptake regulation protein paralog	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	Zinc uptake regulation protein paralog
Patl_0298	Pseudoalteromonas atlantica T6c Gene: Patl_0298: hypothetical protein	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H Gene: CPS_1818: hypothetical protein	Alteromonadales bacterium TW-7 Gene: ATW7_16044: hypothetical protein	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	hypothetical protein
yciC	Pseudoalteromonas atlantica T6c Gene: Patl_0299: Putative metal chaperone, GTPase of COG0523 family	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H Gene: CPS_1815: Putative metal chaperone, GTPase of COG0523 family	* Alteromonadales bacterium TW-7 Site: position = -51 score = 6.06735 sequence = ATATTGATATAATATAACATATC Gene: ATW7_09166: Putative metal chaperone, GTPase of COG0523 family	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	Putative metal chaperone, GTPase of COG0523 family
PF08856	Pseudoalteromonas atlantica T6c Gene: Patl_0300: hypothetical protein	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H Gene: CPS_1816: hypothetical protein	Alteromonadales bacterium TW-7 Gene: ATW7_09171: hypothetical protein	Pseudoalteromonas haloplanktis TAC125	* Pseudoalteromonas tunicata D2 Site: position = -39 score = 5.77924 sequence = CTTTTGATATATTATCACATAAC Gene: PTD2_00701: hypothetical protein	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	hypothetical protein

CRON 7.
ribA	Pseudoalteromonas atlantica T6c	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H Gene: CPS_1824: GTP cyclohydrolase II (EC 3.5.4.25)	* Alteromonadales bacterium TW-7 Site: position = -59 score = 5.23254 sequence = CTTTTGTGATACTATCACTTTAT Gene: ATW7_11681: GTP cyclohydrolase II (EC 3.5.4.25)	* Pseudoalteromonas haloplanktis TAC125 Site: position = -59 score = 5.40053 sequence = CTTTTGTGATAATATCACTTCAT Gene: PSHAa0529: GTP cyclohydrolase II (EC 3.5.4.25)	2 Pseudoalteromonas tunicata D2* Gene: PTD2_14452: GTP cyclohydrolase II (EC 3.5.4.25) Site: position = -47 score = 6.04541 sequence = CTTTTGTTATATTATCACAATAT Gene: PTD2_14447: GTP cyclohydrolase II (EC 3.5.4.25)	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	GTP cyclohydrolase II (EC 3.5.4.25)

CRON 8.
PF03203	* Pseudoalteromonas atlantica T6c Site: position = -45 score = 6.16751 sequence = TTGATGTTATATTATAACGTTCA Gene: Patl_3486: MerC-like membrane protein	* Alteromonas macleodii 'Deep ecotype' Site: position = -163 score = 5.41246 sequence = AGTCTGTTATAATATAACGTCTC Gene: MADE_00546: MerC-like membrane protein	* Glaciecola sp. HTCC2999 Site: position = -49 score = 6.27493 sequence = TTTATGTTATACTATAACATCGA Gene: GHTCC_010100002164: MerC-like membrane protein	* Colwellia psychrerythraea 34H Site: position = -94 score = 5.96206 sequence = CTAATGTTATATTATATCAATTG Gene: CPS_0396: MerC-like membrane protein	Alteromonadales bacterium TW-7	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	* Idiomarina baltica OS145 Site: position = -43 score = 5.73465 sequence = CGTATGTTATAATATAACAGGCT Gene: OS145_08107: MerC-like membrane protein	* Idiomarina loihiensis L2TR Site: position = -50 score = 5.7462 sequence = CGTATGTTATAATATTACAGCTT Gene: IL2274: MerC-like membrane protein	MerC-like membrane protein

CRON 9.
PF11751	Pseudoalteromonas atlantica T6c	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999	* Colwellia psychrerythraea 34H Site: position = -191 score = 5.29884 sequence = TACTTGTTATAGTATAACACTTA Gene: CPS_4490: Putative exported protein	Alteromonadales bacterium TW-7	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	Putative exported protein

CRON 10.
omr1	* Pseudoalteromonas atlantica T6c Site: position = -65 score = 5.45275 sequence = AATTGGTTACAATATAACATAAC Site: position = -36 score = 6.16436 sequence = TAAATGATACAATATAACATCAC Gene: Patl_0295: Zinc-regulated outer membrane receptor	Alteromonas macleodii 'Deep ecotype'	* Glaciecola sp. HTCC2999 Site: position = -53 score = 6.25882 sequence = GTAATGTGATATTATAACATTTC Gene: GHTCC_010100001624: Zinc-regulated outer membrane receptor	* Colwellia psychrerythraea 34H Site: position = -194 score = 6.44099 sequence = ATAATGTGATAATATAACATTAT Site: position = -169 score = 5.4576 sequence = AAATTGTTACATTATCACATTGG Gene: CPS_1902: Zinc-regulated outer membrane receptor	* Alteromonadales bacterium TW-7 Site: position = -36 score = 5.70791 sequence = CAATTGATACAATATAACATCTA Site: position = -64 score = 6.04821 sequence = CTATTGATATAATATAACATATA Gene: ATW7_16054: Zinc-regulated outer membrane receptor	Pseudoalteromonas haloplanktis TAC125	Pseudoalteromonas tunicata D2	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	Zinc-regulated outer membrane receptor

CRON 11.
rpmE2	Pseudoalteromonas atlantica T6c	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H	Alteromonadales bacterium TW-7	Pseudoalteromonas haloplanktis TAC125	* Pseudoalteromonas tunicata D2 Site: position = -34 score = 5.68876 sequence = GTTATGATATACTATCACATAAT Gene: PTD2_02796: LSU ribosomal protein L31p	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	LSU ribosomal protein L31p
rpmJ	Pseudoalteromonas atlantica T6c	Alteromonas macleodii 'Deep ecotype'	Glaciecola sp. HTCC2999	Colwellia psychrerythraea 34H	Alteromonadales bacterium TW-7	* Pseudoalteromonas haloplanktis TAC125 Site: position = -73 score = 5.64342 sequence = AAAATGATACAATATCACATAAC Gene: PSHAb0382: LSU ribosomal protein L36p	Pseudoalteromonas tunicata D2 Gene: PTD2_02801: LSU ribosomal protein L36p	Idiomarina baltica OS145	Idiomarina loihiensis L2TR	LSU ribosomal protein L36p

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Zur - Alteromonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --