Regulon of Zur in Pseudoalteromonas atlantica T6c

Properties
Regulator type:	Transcription factor
TF locus tag:	Patl_0247, Patl_0297
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Alteromonadales
Statistics of regulated genes:
- Genes	14
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 5.8 Sequence: TTATCGTTATAATATAACATAGC Position: -32 Score: 6.2 Sequence: ATTATGTTATATTATAACGATAC Locus tag: Patl_3773 Name: COG4525 Funciton: ABC transporter ATP-binding protein Locus tag: Patl_3774 Name: COG1277 Funciton: hypothetical protein Locus tag: Patl_3775 Name: PF12040 Funciton: Gll1302 protein Locus tag: Patl_3776 Name: foxA Funciton: TonB-dependent siderophore receptor
	Patl_3773	COG4525	ABC transporter ATP-binding protein
	Patl_3774	COG1277	hypothetical protein
	Patl_3775	PF12040	Gll1302 protein
	Patl_3776	foxA	TonB-dependent siderophore receptor
Position: -58 Score: 5.8 Sequence: ATTATGTGATAACATAACATTTT Locus tag: Patl_0331 Name: PF05787 Funciton: hypothetical protein
	Patl_0331	PF05787	hypothetical protein
Position: -204 Score: 5.4 Sequence: GTGATGTTATATTGTATCATTTA Position: -175 Score: 4.9 Sequence: GTTATGTTATATTGTAACCAATT Locus tag: Patl_0296 Name: zbp Funciton: Predicted zinc-binding protein Locus tag: Patl_0297 Name: zur2 Funciton: Zinc uptake regulation protein paralog Locus tag: Patl_0298 Name: null Funciton: hypothetical protein Locus tag: Patl_0299 Name: yciC Funciton: Putative metal chaperone, GTPase of COG0523 family Locus tag: Patl_0300 Name: PF08856 Funciton: hypothetical protein
	Patl_0296	zbp	Predicted zinc-binding protein
	Patl_0297	zur2	Zinc uptake regulation protein paralog
	Patl_0298		hypothetical protein
	Patl_0299	yciC	Putative metal chaperone, GTPase of COG0523 family
	Patl_0300	PF08856	hypothetical protein
Position: -67 Score: 5.6 Sequence: CTATTGATATGTTATAACATTTA Locus tag: Patl_0305 Name: PF11736 Funciton: lipoprotein, putative
	Patl_0305	PF11736	lipoprotein, putative
Position: -65 Score: 5.5 Sequence: AATTGGTTACAATATAACATAAC Position: -36 Score: 6.2 Sequence: TAAATGATACAATATAACATCAC Locus tag: Patl_0295 Name: omr1 Funciton: Zinc-regulated outer membrane receptor
	Patl_0295	omr1	Zinc-regulated outer membrane receptor
Position: -55 Score: 6.3 Sequence: TTGGTGTTATATTATAACATCAC Locus tag: Patl_3627 Name: omr Funciton: Zinc-regulated outer membrane receptor
	Patl_3627	omr	Zinc-regulated outer membrane receptor
Position: -45 Score: 6.2 Sequence: TTGATGTTATATTATAACGTTCA Locus tag: Patl_3486 Name: PF03203 Funciton: MerC-like membrane protein
	Patl_3486	PF03203	MerC-like membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of Zur in Pseudoalteromonas atlantica T6c

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --