Regulon of Zur in Pseudoalteromonas haloplanktis TAC125

Properties
Regulator type:	Transcription factor
TF locus tag:	PSHAa0493
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Alteromonadales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 5.4 Sequence: CTTTTGTGATAATATCACTTCAT Locus tag: PSHAa0529 Name: ribA Funciton: GTP cyclohydrolase II (EC 3.5.4.25)
	PSHAa0529	ribA	GTP cyclohydrolase II (EC 3.5.4.25)
Position: -73 Score: 5.6 Sequence: AAAATGATACAATATCACATAAC Locus tag: PSHAb0382 Name: rpmJ Funciton: LSU ribosomal protein L36p
	PSHAb0382	rpmJ	LSU ribosomal protein L36p
Position: -86 Score: 6.3 Sequence: ATAAGGTTATACTATAACATCAT Position: -48 Score: 5.3 Sequence: GTAGTGTTATATTATATCACAAC Locus tag: PSHAa1415 Name: omr Funciton: Zinc-regulated outer membrane receptor
	PSHAa1415	omr	Zinc-regulated outer membrane receptor

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD