Regulon of Zur in Glaciecola sp. HTCC2999

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Alteromonadales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -53 Score: 6.3 Sequence: GTAATGTGATATTATAACATTTC Locus tag: GHTCC_010100001624 Name: omr1 Funciton: Zinc-regulated outer membrane receptor
	GHTCC_010100001624	omr1	Zinc-regulated outer membrane receptor
Position: -49 Score: 6.3 Sequence: TTTATGTTATACTATAACATCGA Locus tag: GHTCC_010100002164 Name: PF03203 Funciton: MerC-like membrane protein
	GHTCC_010100002164	PF03203	MerC-like membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD