Regulon of Zur in Alteromonadales bacterium TW-7

Properties
Regulator type:	Transcription factor
TF locus tag:	ATW7_16049, ATW7_18660
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Alteromonadales
Statistics of regulated genes:
- Genes	11
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -56 Score: 6 Sequence: GAGTTGTTATAGTATAACATCCC Locus tag: ATW7_12973 Name: COG4525 Funciton: ABC transporter ATP-binding protein Locus tag: ATW7_12968 Name: COG1277 Funciton: hypothetical protein Locus tag: ATW7_12963 Name: PF12040 Funciton: Gll1302 protein Locus tag: ATW7_12958 Name: foxA Funciton: TonB-dependent siderophore receptor
	ATW7_12973	COG4525	ABC transporter ATP-binding protein
	ATW7_12968	COG1277	hypothetical protein
	ATW7_12963	PF12040	Gll1302 protein
	ATW7_12958	foxA	TonB-dependent siderophore receptor
Position: -51 Score: 6.1 Sequence: ATATTGATATAATATAACATATC Locus tag: ATW7_09166 Name: yciC Funciton: Putative metal chaperone, GTPase of COG0523 family Locus tag: ATW7_09171 Name: PF08856 Funciton: hypothetical protein
	ATW7_09166	yciC	Putative metal chaperone, GTPase of COG0523 family
	ATW7_09171	PF08856	hypothetical protein
Position: -146 Score: 5.1 Sequence: TAGATGTTATATTGTATCAATTG Position: -118 Score: 5.9 Sequence: TATATGTTATATTATATCAATAG Locus tag: ATW7_16049 Name: zur2 Funciton: Zinc uptake regulation protein paralog Locus tag: ATW7_16044 Name: null Funciton: hypothetical protein
	ATW7_16049	zur2	Zinc uptake regulation protein paralog
	ATW7_16044		hypothetical protein
Position: -64 Score: 6 Sequence: CTATTGATATAATATAACATATA Position: -36 Score: 5.7 Sequence: CAATTGATACAATATAACATCTA Locus tag: ATW7_16054 Name: omr1 Funciton: Zinc-regulated outer membrane receptor
	ATW7_16054	omr1	Zinc-regulated outer membrane receptor
Position: -85 Score: 6 Sequence: TAAAAGTTATAGTATAACATTGT Position: -47 Score: 5 Sequence: GAACTGTTATATTATATCACAAC Locus tag: ATW7_07102 Name: omr Funciton: Zinc-regulated outer membrane receptor
	ATW7_07102	omr	Zinc-regulated outer membrane receptor
Position: -59 Score: 5.2 Sequence: CTTTTGTGATACTATCACTTTAT Locus tag: ATW7_11681 Name: ribA Funciton: GTP cyclohydrolase II (EC 3.5.4.25)
	ATW7_11681	ribA	GTP cyclohydrolase II (EC 3.5.4.25)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD