Regulon of Zur in Idiomarina baltica OS145

Properties
Regulator type:	Transcription factor
TF locus tag:	OS145_05740
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Alteromonadales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -67 Score: 6.5 Sequence: GTAATGTTATATTATCACATTAA Locus tag: OS145_12066 Name: omr Funciton: Zinc-regulated outer membrane receptor
	OS145_12066	omr	Zinc-regulated outer membrane receptor
Position: -43 Score: 5.7 Sequence: CGTATGTTATAATATAACAGGCT Locus tag: OS145_08107 Name: PF03203 Funciton: MerC-like membrane protein
	OS145_08107	PF03203	MerC-like membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD