Regulon of Zur in Alteromonas macleodii 'Deep ecotype'

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Alteromonadales
Statistics of regulated genes:
- Genes	7
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 6.1 Sequence: TTATGGTAATAATATAACATTAC Position: -50 Score: 5.2 Sequence: GTAATAATATAACATTACAACAC Locus tag: MADE_01807 Name: COG4525 Funciton: ABC transporter ATP-binding protein Locus tag: MADE_01806 Name: COG1277 Funciton: hypothetical protein Locus tag: MADE_01805 Name: PF12040 Funciton: Gll1302 protein
	MADE_01807	COG4525	ABC transporter ATP-binding protein
	MADE_01806	COG1277	hypothetical protein
	MADE_01805	PF12040	Gll1302 protein
Position: -25 Score: 5.8 Sequence: AAAATGAGATAACATAACATCAC Locus tag: MADE_01528 Name: omr2 Funciton: Zinc-regulated outer membrane receptor
	MADE_01528	omr2	Zinc-regulated outer membrane receptor
Position: -87 Score: 5.5 Sequence: ATGTTGTTATAGTGTAACAATAT Locus tag: MADE_00705 Name: PF05787 Funciton: hypothetical protein
	MADE_00705	PF05787	hypothetical protein
Position: -52 Score: 5.4 Sequence: AAAATGTTATAACATCACTAAAT Locus tag: MADE_03676 Name: omr Funciton: Zinc-regulated outer membrane receptor
	MADE_03676	omr	Zinc-regulated outer membrane receptor
Position: -163 Score: 5.4 Sequence: AGTCTGTTATAATATAACGTCTC Locus tag: MADE_00546 Name: PF03203 Funciton: MerC-like membrane protein
	MADE_00546	PF03203	MerC-like membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD