Regulon of Zur in Colwellia psychrerythraea 34H

Properties
Regulator type:	Transcription factor
TF locus tag:	CPS_0412
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Alteromonadales
Statistics of regulated genes:
- Genes	4
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 5.9 Sequence: TTTATGTTATGTTATAACATTGA Locus tag: CPS_1814 Name: PF11736 Funciton: lipoprotein, putative
	CPS_1814	PF11736	lipoprotein, putative
Position: -191 Score: 5.3 Sequence: TACTTGTTATAGTATAACACTTA Locus tag: CPS_4490 Name: PF11751 Funciton: Putative exported protein
	CPS_4490	PF11751	Putative exported protein
Position: -194 Score: 6.4 Sequence: ATAATGTGATAATATAACATTAT Position: -169 Score: 5.5 Sequence: AAATTGTTACATTATCACATTGG Locus tag: CPS_1902 Name: omr1 Funciton: Zinc-regulated outer membrane receptor
	CPS_1902	omr1	Zinc-regulated outer membrane receptor
Position: -94 Score: 6 Sequence: CTAATGTTATATTATATCAATTG Locus tag: CPS_0396 Name: PF03203 Funciton: MerC-like membrane protein
	CPS_0396	PF03203	MerC-like membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD