Regulog GalR/GalS - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor (activator) |
| Biological process: | Galactose utilization |
| Effector: | Galactose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By effector - Galactose
- By pathway - Galactose utilization
| Genome | Genes | Operons |
|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | 14 | 6 |
| Salmonella typhimurium LT2 | 7 | 4 |
| Citrobacter koseri ATCC BAA-895 | 17 | 7 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 17 | 7 |
| Enterobacter sp. 638 | 17 | 7 |
| Erwinia amylovora ATCC 49946 | 6 | 4 |
| Yersinia pestis KIM | 5 | 3 |
| Serratia proteamaculans 568 | 9 | 5 |
| Erwinia carotovora subsp. atroseptica SCRI1043 | 12 | 5 |
| Edwardsiella tarda EIB202 | 6 | 3 |
| Proteus mirabilis HI4320 | 6 | 3 |
| Photorhabdus luminescens subsp. laumondii TTO1 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| galR |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -32 score = 5.23435 sequence = GAATGTAAGCGTTTACCCAC Gene: b2837: galactose operon repressor galR |
*
Salmonella typhimurium LT2 Site: position = -33 score = 5.34706 sequence = TAATGTAAGCGTTTACCCAC Gene: STM3011: galactose operon repressor galR |
*
Citrobacter koseri ATCC BAA-895 Site: position = -33 score = 5.10755 sequence = AAATGTAAGCGTTTACCCAC Gene: CKO_04211: galactose operon repressor galR |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -33 score = 5.4768 sequence = GTATGTAAACGCTTACCCTA Gene: KPN_03246: galactose operon repressor galR |
*
Enterobacter sp. 638 Site: position = -35 score = 5.28439 sequence = GTGTGTAAACGCTTACCCCC Gene: Ent638_3278: galactose operon repressor galR |
*
Erwinia amylovora ATCC 49946 Site: position = -35 score = 4.90868 sequence = AAATGTAAACGCTTACCCAG Gene: EAM_2770: galactose operon repressor galR |
*
Yersinia pestis KIM Site: position = 32 score = 5.39524 sequence = TGATGTAAGCGGTTACCCTA Gene: y3183: galactose operon repressor galR |
*
Serratia proteamaculans 568 Site: position = -34 score = 5.19158 sequence = GAATGTAAGCGATTACCCAG Gene: Spro_3832: galactose operon repressor galR |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -240 score = 5.32283 sequence = AAGTGTAATCGGTTACCCTA Gene: ECA3172: galactose operon repressor galR |
*
Edwardsiella tarda EIB202 Site: position = -41 score = 5.18282 sequence = TGGTGTAAACGTTTACGGTT Gene: ETAE_2890: galactose operon repressor galR |
*
Proteus mirabilis HI4320 Site: position = -168 score = 5.32255 sequence = AAGTGTAAACGCTTTCCTTT Gene: PMI1947: galactose operon repressor galR |
|
galactose operon repressor galR |
| CRON 2. | |||||||||||||
| galE |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -96 score = 6.56073 sequence = TTGTGTAAACGATTCCACTA Gene: b0759: UDP-galactose-4-epimerase |
*
Salmonella typhimurium LT2 Site: position = -96 score = 6.44801 sequence = GTGTGTAAACGATTCCACTA Gene: STM0776: UDP-galactose-4-epimerase |
*
Citrobacter koseri ATCC BAA-895 Site: position = -54 score = 6.38716 sequence = AAGTGTAAACGATTCCACTA Gene: CKO_02376: UDP-galactose-4-epimerase |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -96 score = 6.38716 sequence = AAGTGTAAACGATTCCACTA Site: position = -252 score = 4.86571 sequence = CAGTGGAGACGGTTACACTT Gene: KPN_00773: UDP-galactose-4-epimerase |
*
Enterobacter sp. 638 Site: position = -96 score = 6.23269 sequence = CGGTGTAACCGATTCCACTA Gene: Ent638_1250: UDP-galactose-4-epimerase |
|
*
Yersinia pestis KIM Site: position = -95 score = 6.41098 sequence = GAGTGTAAACGATTCCATTA Gene: y3043: UDP-galactose-4-epimerase |
|
Gene: ECA1389: UDP-galactose-4-epimerase |
*
Edwardsiella tarda EIB202 Site: position = -95 score = 6.42666 sequence = TAGTGTAAACGATTCCATTT Site: position = -195 score = 5.46422 sequence = TAGTGTAAGCGATACCACAA Gene: ETAE_2564: UDP-galactose-4-epimerase |
*
Proteus mirabilis HI4320 Site: position = -126 score = 6.06806 sequence = GCGTGTAAACGTTTACACTA Site: position = -259 score = 5.3169 sequence = TAATGTAATCGTTTACTTTT Gene: PMI1951: UDP-galactose-4-epimerase |
|
UDP-galactose-4-epimerase |
| galT |
Gene: b0758: galactose-1-phosphate uridylyltransferase |
Gene: STM0775: galactose-1-phosphate uridylyltransferase |
Gene: CKO_02377: galactose-1-phosphate uridylyltransferase |
Gene: KPN_00772: galactose-1-phosphate uridylyltransferase |
Gene: Ent638_1249: galactose-1-phosphate uridylyltransferase |
*
Erwinia amylovora ATCC 49946 Site: position = -197 score = 5.0752 sequence = CTATGTAATCGTTTTCAACA Site: position = -108 score = 6.42666 sequence = TAGTGTAAACGATTCCATTT Gene: EAM_1197: galactose-1-phosphate uridylyltransferase |
Gene: y3044: galactose-1-phosphate uridylyltransferase |
*
Serratia proteamaculans 568 Site: position = -50 score = 5.03136 sequence = AGGTGAAAGCGATTACACAC Site: position = -160 score = 6.12121 sequence = CTGTGTAAACGATTCCATTT Gene: Spro_1292: galactose-1-phosphate uridylyltransferase |
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -240 score = 5.99472 sequence = TAGGGTAACCGATTACACTT Site: position = -152 score = 5.01649 sequence = TAGTGAAACTGATTACATTG Gene: ECA3171: galactose-1-phosphate uridylyltransferase |
Gene: ETAE_2565: galactose-1-phosphate uridylyltransferase |
Gene: PMI1950: galactose-1-phosphate uridylyltransferase |
Gene: plu0575: galactose-1-phosphate uridylyltransferase |
galactose-1-phosphate uridylyltransferase |
| galK |
Gene: b0757: galactokinase |
Gene: STM0774: galactokinase |
Gene: CKO_02378: galactokinase |
Gene: KPN_00771: galactokinase |
Gene: Ent638_1248: galactokinase |
Gene: EAM_1196: galactokinase |
Gene: y3045: galactokinase |
Gene: Spro_1291: galactokinase |
Gene: ECA3170: galactokinase |
Gene: ETAE_2566: galactokinase |
Gene: PMI1949: galactokinase |
Gene: plu0576: galactokinase |
galactokinase |
| galM |
Gene: b0756: galactose-1-epimerase (mutarotase) |
Gene: STM0773: galactose-1-epimerase (mutarotase) |
Gene: CKO_02379: galactose-1-epimerase (mutarotase) |
Gene: KPN_00770: galactose-1-epimerase (mutarotase) |
Gene: Ent638_1247: galactose-1-epimerase (mutarotase) |
Gene: EAM_1195: galactose-1-epimerase (mutarotase) |
|
Gene: Spro_1290: galactose-1-epimerase (mutarotase) |
Gene: ECA1388: galactose-1-epimerase (mutarotase) |
Gene: ETAE_2567: galactose-1-epimerase (mutarotase) |
Gene: PMI1948: galactose-1-epimerase (mutarotase) |
Gene: plu0577: galactose-1-epimerase (mutarotase) |
galactose-1-epimerase (mutarotase) |
| CRON 3. | |||||||||||||
| galS |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -113 score = 5.54982 sequence = GGCTGTAACCGTTTCCATTG Gene: b2151: galactose operon repressor galS |
*
Salmonella typhimurium LT2 Site: position = -121 score = 5.36901 sequence = GGCTGTAACCGTTTCCATCC Gene: STM2191: galactose operon repressor galS |
*
Citrobacter koseri ATCC BAA-895 Site: position = -124 score = 4.94368 sequence = GCATGTAACCGTTTCCAGCC Gene: CKO_00640: galactose operon repressor galS |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -127 score = 5.22174 sequence = GGATGTAAACGTTTCCAGCC Gene: KPN_02589: galactose operon repressor galS |
*
Enterobacter sp. 638 Site: position = -127 score = 5.48274 sequence = GGATGTAACCGTTTTCATCT Gene: Ent638_2751: galactose operon repressor galS |
*
Erwinia amylovora ATCC 49946 Site: position = -128 score = 4.86789 sequence = GGCTGTAACCGTTTTCATGG Gene: EAM_2208: galactose operon repressor galS |
|
*
Serratia proteamaculans 568 Site: position = -102 score = 5.44047 sequence = GTATGTAAACGTTTTCTTTC Gene: Spro_1562: galactose operon repressor galS |
|
|
|
|
galactose operon repressor galS |
| CRON 4. | |||||||||||||
| galP |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -282 score = 4.97665 sequence = AACTGAAACCGATTACACCA Site: position = -100 score = 6.18422 sequence = TAGTGTAAGCGATTACACTG Gene: b2943: galactose transporter |
*
Salmonella typhimurium LT2 Site: position = -283 score = 4.74752 sequence = TCATGAAAGCGGTTACATTC Site: position = -101 score = 6.06397 sequence = CAGTGTAAACGATTACACCA Gene: STM3091: galactose transporter |
*
Citrobacter koseri ATCC BAA-895 Site: position = -282 score = 5.21755 sequence = TAATGAAACCGTTTACCCTC Site: position = -101 score = 6.61108 sequence = TAGTGTAAACGATTACACTA Gene: CKO_04318: galactose transporter |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -285 score = 4.72487 sequence = AAATGAAAGCGATTACATAG Site: position = -102 score = 5.56167 sequence = TTGTGGAAACGATTACACAG Gene: KPN_03376: galactose transporter |
*
Enterobacter sp. 638 Site: position = -284 score = 5.0275 sequence = AAATGAAAGCGATTACACCA Site: position = -102 score = 6.26035 sequence = TAGTGTAACCGATTACACCA Gene: Ent638_3347: galactose transporter |
*
Erwinia amylovora ATCC 49946 Site: position = -170 score = 5.55279 sequence = TGTTGTAACCGGTTACATTC Gene: EAM_2827: galactose transporter |
|
*
Serratia proteamaculans 568 Site: position = -274 score = 4.3191 sequence = GTGTGATATCGGTTACATTT Site: position = -100 score = 6.11719 sequence = TTGTGTAATCGTTTCCACTA Gene: Spro_1160: galactose transporter |
|
*
Edwardsiella tarda EIB202 Site: position = -273 score = 5.55037 sequence = AAGTGAAAACGATTACATTT Site: position = -79 score = 6.04436 sequence = GTATGTAAACGATTACATTT Gene: ETAE_2966: galactose transporter |
|
|
galactose transporter |
| CRON 5. | |||||||||||||
| mglB |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -287 score = 5.28164 sequence = CGATGTAACCGCTTTCAATC Gene: b2150: beta-methylgalactoside ABC transporter, periplasmic binding protein |
|
*
Citrobacter koseri ATCC BAA-895 Site: position = -287 score = 5.4813 sequence = GGATGTAACCGCTTTCAATA Gene: CKO_00641: beta-methylgalactoside ABC transporter, periplasmic binding protein |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -256 score = 5.38426 sequence = GGATGTAACCGCTTTCAATT Gene: KPN_02588: beta-methylgalactoside ABC transporter, periplasmic binding protein |
*
Enterobacter sp. 638 Site: position = -288 score = 5.82043 sequence = TGATGTAACCGTTTTCAATC Gene: Ent638_2750: beta-methylgalactoside ABC transporter, periplasmic binding protein |
|
*
Yersinia pestis KIM Site: position = -229 score = 5.83294 sequence = TTGTGTAACCGGTTTCAATC Gene: y2662: beta-methylgalactoside ABC transporter, periplasmic binding protein |
*
Serratia proteamaculans 568 Site: position = -246 score = 6.0539 sequence = TTGTGTAACCGTTTTCAATC Gene: Spro_1563: beta-methylgalactoside ABC transporter, periplasmic binding protein |
|
|
|
|
beta-methylgalactoside ABC transporter, periplasmic binding protein |
| mglA |
Gene: b2149: beta-methylgalactoside ABC transporter, ATP-binding protein |
|
Gene: CKO_00642: beta-methylgalactoside ABC transporter, ATP-binding protein |
Gene: KPN_02587: beta-methylgalactoside ABC transporter, ATP-binding protein |
Gene: Ent638_2749: beta-methylgalactoside ABC transporter, ATP-binding protein |
|
Gene: y2661: beta-methylgalactoside ABC transporter, ATP-binding protein |
Gene: Spro_1564: beta-methylgalactoside ABC transporter, ATP-binding protein |
|
|
|
|
beta-methylgalactoside ABC transporter, ATP-binding protein |
| mglC |
Gene: b2148: beta-methylgalactoside ABC transporter, inner membrane component |
|
Gene: CKO_00643: beta-methylgalactoside ABC transporter, inner membrane component |
Gene: KPN_02586: beta-methylgalactoside ABC transporter, inner membrane component |
Gene: Ent638_2748: beta-methylgalactoside ABC transporter, inner membrane component |
|
Gene: y2660: beta-methylgalactoside ABC transporter, inner membrane component |
Gene: Spro_1565: beta-methylgalactoside ABC transporter, inner membrane component |
|
|
|
|
beta-methylgalactoside ABC transporter, inner membrane component |
| CRON 6. | |||||||||||||
| ytfQ |
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -147 score = 4.63351 sequence = AGATGAAAGCGATTACAAAC Site: position = 0 score = 4.47592 sequence = ATGTGGAAACGCTTACTTAT Gene: b4227: periplasmic binding protein/LacI transcriptional regulator |
|
*
Citrobacter koseri ATCC BAA-895 Site: position = -148 score = 4.74486 sequence = GAATGAAAGCGATTACAAAG Site: position = 0 score = 4.55632 sequence = ATGTGGAAGCGCTTACTTTT Gene: CKO_03603: periplasmic binding protein/LacI transcriptional regulator |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -283 score = 5.84584 sequence = TTATGTAACCGTTTTCATTG Site: position = -42 score = 4.24872 sequence = ATGTGGAAGCGCTTACTTCT Gene: KPN_04622: periplasmic binding protein/LacI transcriptional regulator |
*
Enterobacter sp. 638 Site: position = -148 score = 4.87165 sequence = GAATGAAAGCGATTACAAAC Site: position = -94 score = 4.31832 sequence = TGATGTAACGCATTCCGTTA Site: position = 0 score = 4.14191 sequence = ATGTGGAAGCGCTTACTACT Gene: Ent638_0412: periplasmic binding protein/LacI transcriptional regulator |
|
|
|
|
|
|
|
periplasmic binding protein/LacI transcriptional regulator |
| ytfR |
Gene: b4485: putative sugar transport protein (ABC superfamily, atp_bind) |
|
Gene: CKO_03602: putative sugar transport protein (ABC superfamily, atp_bind) |
Gene: KPN_04623: putative sugar transport protein (ABC superfamily, atp_bind) |
Gene: Ent638_0413: putative sugar transport protein (ABC superfamily, atp_bind) |
|
|
|
|
|
|
|
putative sugar transport protein (ABC superfamily, atp_bind) |
| ytfT |
Gene: b4230: putative sugar transport protein (ABC superfamily, membrane) |
|
Gene: CKO_03601: putative sugar transport protein (ABC superfamily, membrane) |
Gene: KPN_04624: putative sugar transport protein (ABC superfamily, membrane) |
Gene: Ent638_0414: putative sugar transport protein (ABC superfamily, membrane) |
|
|
|
|
|
|
|
putative sugar transport protein (ABC superfamily, membrane) |
| yjfF |
Gene: b4231: inner membrane ABC transporter permease protein |
|
Gene: CKO_03600: inner membrane ABC transporter permease protein |
Gene: KPN_04625: inner membrane ABC transporter permease protein |
Gene: Ent638_0415: inner membrane ABC transporter permease protein |
|
|
|
|
|
|
|
inner membrane ABC transporter permease protein |
| CRON 7. | |||||||||||||
| ganK |
|
|
|
Gene: KPN_00426: oligogalactan ABC transporter, ATP-binding protein |
|
|
Gene: y3242: oligogalactan ABC transporter, ATP-binding protein |
|
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -178 score = 5.31135 sequence = TTGTGCAAACGGTTACACCA Gene: ECA3174: oligogalactan ABC transporter, ATP-binding protein |
|
|
|
oligogalactan ABC transporter, ATP-binding protein |
| CRON 8. | |||||||||||||
| ganE |
|
|
|
Gene: KPN_00427: oligogalactan ABC transporter, substrate-binding periplasmic protein |
|
|
Gene: y3241: oligogalactan ABC transporter, substrate-binding periplasmic protein |
|
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -229 score = 4.76604 sequence = TGGTGTAACCGTTACCCTAG Site: position = -335 score = 5.60361 sequence = TGGTGTAACCGTTTGCACAA Gene: ECA3175: oligogalactan ABC transporter, substrate-binding periplasmic protein |
|
|
|
oligogalactan ABC transporter, substrate-binding periplasmic protein |
| ganF |
|
|
|
Gene: KPN_00428: oligogalactan ABC transporter, permease protein |
|
|
Gene: y3240: oligogalactan ABC transporter, permease protein |
|
Gene: ECA3176: oligogalactan ABC transporter, permease protein |
|
|
|
oligogalactan ABC transporter, permease protein |
| ganG |
|
|
|
Gene: KPN_00429: oligogalactan ABC transporter, permease protein |
|
|
Gene: y3239: oligogalactan ABC transporter, permease protein |
|
Gene: ECA3177: oligogalactan ABC transporter, permease protein |
|
|
|
oligogalactan ABC transporter, permease protein |
| ganA |
|
|
|
Gene: KPN_00430: galactanase |
|
|
Gene: y3238: galactanase |
|
Gene: ECA3178: galactanase |
|
|
|
galactanase |
| lacA |
|
|
|
Gene: KPN_00431: beta-galactosidase |
|
|
Gene: y3237: beta-galactosidase |
|
Gene: ECA3179: beta-galactosidase |
|
|
|
beta-galactosidase |
| CRON 9. | |||||||||||||
| ECA1400 |
|
|
*
Citrobacter koseri ATCC BAA-895 Site: position = -38 score = 4.86055 sequence = ATTTGTAATCGATTACTTTT Site: position = -70 score = 5.10006 sequence = TTTTGTAATCGATTACTTTT Gene: CKO_02603: putative nucleoside H+ symporter |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -35 score = 5.10006 sequence = TTTTGTAATCGATTACTTTT Site: position = -66 score = 5.10006 sequence = TTTTGTAATCGATTACTTTT Gene: KPN_00538: putative nucleoside H+ symporter |
*
Enterobacter sp. 638 Site: position = -37 score = 5.10006 sequence = TTTTGTAATCGATTACTTTT Site: position = -68 score = 5.10006 sequence = TTTTGTAATCGATTACTTTT Gene: Ent638_1060: putative nucleoside H+ symporter |
|
|
|
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -34 score = 5.05328 sequence = GATTGTAATCGATTACTTTT Site: position = -64 score = 5.0028 sequence = AAAAGTAATCGATTACATTT Gene: ECA1400: putative nucleoside H+ symporter |
|
|
|
putative nucleoside H+ symporter |
| ECA1399 |
|
|
Gene: CKO_02602: putative xylose isomerase-like TIM barrel |
Gene: KPN_00539: putative xylose isomerase-like TIM barrel |
Gene: Ent638_1061: putative xylose isomerase-like TIM barrel |
|
|
|
Gene: ECA1399: putative xylose isomerase-like TIM barrel |
|
|
|
putative xylose isomerase-like TIM barrel |
| ECA1398 |
|
|
Gene: CKO_02601: putative NADH-dependent dehydrogenase |
Gene: KPN_00540: putative NADH-dependent dehydrogenase |
Gene: Ent638_1062: putative NADH-dependent dehydrogenase |
|
|
|
Gene: ECA1398: putative NADH-dependent dehydrogenase |
|
|
|
putative NADH-dependent dehydrogenase |
| CRON 10. | |||||||||||||
| sglT |
|
|
|
|
|
|
|
|
|
|
*
Proteus mirabilis HI4320 Site: position = -58 score = 5.70836 sequence = AAGTGGAAACGTTTACATTA Site: position = -249 score = 4.7616 sequence = TATTGTAACCGTTATCAAAC Gene: PMI1946: predicted sodium/galactose cotransporter |
|
predicted sodium/galactose cotransporter |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |