Regulon of GalR/GalS in Serratia proteamaculans 568

Properties
Regulator type:	Transcription factor
TF locus tag:	Spro_3832, Spro_1562
Regulator family:	LacI
Regulation mode:	repressor (activator)
Biological process:	Galactose utilization
Effector:	Galactose
Regulog:	GalR/GalS - Enterobacteriales
Statistics of regulated genes:
- Genes	9
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Galactose
By pathway - Galactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -102 Score: 5.4 Sequence: GTATGTAAACGTTTTCTTTC Locus tag: Spro_1562 Name: galS Funciton: galactose operon repressor galS
	Spro_1562	galS	galactose operon repressor galS
Position: -34 Score: 5.2 Sequence: GAATGTAAGCGATTACCCAG Locus tag: Spro_3832 Name: galR Funciton: galactose operon repressor galR
	Spro_3832	galR	galactose operon repressor galR
Position: -274 Score: 4.3 Sequence: GTGTGATATCGGTTACATTT Position: -100 Score: 6.1 Sequence: TTGTGTAATCGTTTCCACTA Locus tag: Spro_1160 Name: galP Funciton: galactose transporter
	Spro_1160	galP	galactose transporter
Position: -246 Score: 6.1 Sequence: TTGTGTAACCGTTTTCAATC Locus tag: Spro_1563 Name: mglB Funciton: beta-methylgalactoside ABC transporter, periplasmic binding protein Locus tag: Spro_1564 Name: mglA Funciton: beta-methylgalactoside ABC transporter, ATP-binding protein Locus tag: Spro_1565 Name: mglC Funciton: beta-methylgalactoside ABC transporter, inner membrane component
	Spro_1563	mglB	beta-methylgalactoside ABC transporter, periplasmic binding protein
	Spro_1564	mglA	beta-methylgalactoside ABC transporter, ATP-binding protein
	Spro_1565	mglC	beta-methylgalactoside ABC transporter, inner membrane component
Position: -160 Score: 6.1 Sequence: CTGTGTAAACGATTCCATTT Position: -50 Score: 5 Sequence: AGGTGAAAGCGATTACACAC Locus tag: Spro_1292 Name: galT Funciton: galactose-1-phosphate uridylyltransferase Locus tag: Spro_1291 Name: galK Funciton: galactokinase Locus tag: Spro_1290 Name: galM Funciton: galactose-1-epimerase (mutarotase)
	Spro_1292	galT	galactose-1-phosphate uridylyltransferase
	Spro_1291	galK	galactokinase
	Spro_1290	galM	galactose-1-epimerase (mutarotase)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD