Regulon of GalR/GalS in Edwardsiella tarda EIB202

Properties
Regulator type:	Transcription factor
TF locus tag:	ETAE_2890
Regulator family:	LacI
Regulation mode:	repressor (activator)
Biological process:	Galactose utilization
Effector:	Galactose
Regulog:	GalR/GalS - Enterobacteriales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Galactose
By pathway - Galactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -273 Score: 5.6 Sequence: AAGTGAAAACGATTACATTT Position: -79 Score: 6 Sequence: GTATGTAAACGATTACATTT Locus tag: ETAE_2966 Name: galP Funciton: galactose transporter
	ETAE_2966	galP	galactose transporter
Position: -41 Score: 5.2 Sequence: TGGTGTAAACGTTTACGGTT Locus tag: ETAE_2890 Name: galR Funciton: galactose operon repressor galR
	ETAE_2890	galR	galactose operon repressor galR
Position: -195 Score: 5.5 Sequence: TAGTGTAAGCGATACCACAA Position: -95 Score: 6.4 Sequence: TAGTGTAAACGATTCCATTT Locus tag: ETAE_2564 Name: galE Funciton: UDP-galactose-4-epimerase Locus tag: ETAE_2565 Name: galT Funciton: galactose-1-phosphate uridylyltransferase Locus tag: ETAE_2566 Name: galK Funciton: galactokinase Locus tag: ETAE_2567 Name: galM Funciton: galactose-1-epimerase (mutarotase)
	ETAE_2564	galE	UDP-galactose-4-epimerase
	ETAE_2565	galT	galactose-1-phosphate uridylyltransferase
	ETAE_2566	galK	galactokinase
	ETAE_2567	galM	galactose-1-epimerase (mutarotase)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD