Regulon of GalR/GalS in Proteus mirabilis HI4320

Properties
Regulator type:	Transcription factor
TF locus tag:	PMI1947
Regulator family:	LacI
Regulation mode:	repressor (activator)
Biological process:	Galactose utilization
Effector:	Galactose
Regulog:	GalR/GalS - Enterobacteriales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Galactose
By pathway - Galactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -168 Score: 5.3 Sequence: AAGTGTAAACGCTTTCCTTT Locus tag: PMI1947 Name: galR Funciton: galactose operon repressor galR
	PMI1947	galR	galactose operon repressor galR
Position: -249 Score: 4.8 Sequence: TATTGTAACCGTTATCAAAC Position: -58 Score: 5.7 Sequence: AAGTGGAAACGTTTACATTA Locus tag: PMI1946 Name: sglT Funciton: predicted sodium/galactose cotransporter
	PMI1946	sglT	predicted sodium/galactose cotransporter
Position: -259 Score: 5.3 Sequence: TAATGTAATCGTTTACTTTT Position: -126 Score: 6.1 Sequence: GCGTGTAAACGTTTACACTA Locus tag: PMI1951 Name: galE Funciton: UDP-galactose-4-epimerase Locus tag: PMI1950 Name: galT Funciton: galactose-1-phosphate uridylyltransferase Locus tag: PMI1949 Name: galK Funciton: galactokinase Locus tag: PMI1948 Name: galM Funciton: galactose-1-epimerase (mutarotase)
	PMI1951	galE	UDP-galactose-4-epimerase
	PMI1950	galT	galactose-1-phosphate uridylyltransferase
	PMI1949	galK	galactokinase
	PMI1948	galM	galactose-1-epimerase (mutarotase)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD