Regulon of GalR/GalS in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b2837, b2151
Regulator family:	LacI
Regulation mode:	repressor (activator)
Biological process:	Galactose utilization
Effector:	Galactose
Regulog:	GalR/GalS - Enterobacteriales
Statistics of regulated genes:
- Genes	14
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Galactose
By pathway - Galactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -113 Score: 5.5 Sequence: GGCTGTAACCGTTTCCATTG Locus tag: b2151 Name: galS Funciton: galactose operon repressor galS
	b2151	galS	galactose operon repressor galS
Position: -282 Score: 5 Sequence: AACTGAAACCGATTACACCA Position: -100 Score: 6.2 Sequence: TAGTGTAAGCGATTACACTG Locus tag: b2943 Name: galP Funciton: galactose transporter
	b2943	galP	galactose transporter
Position: -287 Score: 5.3 Sequence: CGATGTAACCGCTTTCAATC Locus tag: b2150 Name: mglB Funciton: beta-methylgalactoside ABC transporter, periplasmic binding protein Locus tag: b2149 Name: mglA Funciton: beta-methylgalactoside ABC transporter, ATP-binding protein Locus tag: b2148 Name: mglC Funciton: beta-methylgalactoside ABC transporter, inner membrane component
	b2150	mglB	beta-methylgalactoside ABC transporter, periplasmic binding protein
	b2149	mglA	beta-methylgalactoside ABC transporter, ATP-binding protein
	b2148	mglC	beta-methylgalactoside ABC transporter, inner membrane component
Position: -147 Score: 4.6 Sequence: AGATGAAAGCGATTACAAAC Position: 0 Score: 4.5 Sequence: ATGTGGAAACGCTTACTTAT Locus tag: b4227 Name: ytfQ Funciton: periplasmic binding protein/LacI transcriptional regulator Locus tag: b4485 Name: ytfR Funciton: putative sugar transport protein (ABC superfamily, atp_bind) Locus tag: b4230 Name: ytfT Funciton: putative sugar transport protein (ABC superfamily, membrane) Locus tag: b4231 Name: yjfF Funciton: inner membrane ABC transporter permease protein
	b4227	ytfQ	periplasmic binding protein/LacI transcriptional regulator
	b4485	ytfR	putative sugar transport protein (ABC superfamily, atp_bind)
	b4230	ytfT	putative sugar transport protein (ABC superfamily, membrane)
	b4231	yjfF	inner membrane ABC transporter permease protein
Position: -32 Score: 5.2 Sequence: GAATGTAAGCGTTTACCCAC Locus tag: b2837 Name: galR Funciton: galactose operon repressor galR
	b2837	galR	galactose operon repressor galR
Position: -96 Score: 6.6 Sequence: TTGTGTAAACGATTCCACTA Locus tag: b0759 Name: galE Funciton: UDP-galactose-4-epimerase Locus tag: b0758 Name: galT Funciton: galactose-1-phosphate uridylyltransferase Locus tag: b0757 Name: galK Funciton: galactokinase Locus tag: b0756 Name: galM Funciton: galactose-1-epimerase (mutarotase)
	b0759	galE	UDP-galactose-4-epimerase
	b0758	galT	galactose-1-phosphate uridylyltransferase
	b0757	galK	galactokinase
	b0756	galM	galactose-1-epimerase (mutarotase)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of GalR/GalS in Escherichia coli str. K-12 substr. MG1655

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --