Regulon of GalR/GalS in Salmonella typhimurium LT2

Properties
Regulator type:	Transcription factor
TF locus tag:	STM3011, STM2191
Regulator family:	LacI
Regulation mode:	repressor (activator)
Biological process:	Galactose utilization
Effector:	Galactose
Regulog:	GalR/GalS - Enterobacteriales
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Galactose
By pathway - Galactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -121 Score: 5.4 Sequence: GGCTGTAACCGTTTCCATCC Locus tag: STM2191 Name: galS Funciton: galactose operon repressor galS
	STM2191	galS	galactose operon repressor galS
Position: -283 Score: 4.7 Sequence: TCATGAAAGCGGTTACATTC Position: -101 Score: 6.1 Sequence: CAGTGTAAACGATTACACCA Locus tag: STM3091 Name: galP Funciton: galactose transporter
	STM3091	galP	galactose transporter
Position: -33 Score: 5.3 Sequence: TAATGTAAGCGTTTACCCAC Locus tag: STM3011 Name: galR Funciton: galactose operon repressor galR
	STM3011	galR	galactose operon repressor galR
Position: -96 Score: 6.4 Sequence: GTGTGTAAACGATTCCACTA Locus tag: STM0776 Name: galE Funciton: UDP-galactose-4-epimerase Locus tag: STM0775 Name: galT Funciton: galactose-1-phosphate uridylyltransferase Locus tag: STM0774 Name: galK Funciton: galactokinase Locus tag: STM0773 Name: galM Funciton: galactose-1-epimerase (mutarotase)
	STM0776	galE	UDP-galactose-4-epimerase
	STM0775	galT	galactose-1-phosphate uridylyltransferase
	STM0774	galK	galactokinase
	STM0773	galM	galactose-1-epimerase (mutarotase)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD