Regulon of GalR/GalS in Erwinia amylovora ATCC 49946

Properties
Regulator type:	Transcription factor
TF locus tag:	EAM_2770, EAM_2208
Regulator family:	LacI
Regulation mode:	repressor (activator)
Biological process:	Galactose utilization
Effector:	Galactose
Regulog:	GalR/GalS - Enterobacteriales
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Galactose
By pathway - Galactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -128 Score: 4.9 Sequence: GGCTGTAACCGTTTTCATGG Locus tag: EAM_2208 Name: galS Funciton: galactose operon repressor galS
	EAM_2208	galS	galactose operon repressor galS
Position: -170 Score: 5.6 Sequence: TGTTGTAACCGGTTACATTC Locus tag: EAM_2827 Name: galP Funciton: galactose transporter
	EAM_2827	galP	galactose transporter
Position: -35 Score: 4.9 Sequence: AAATGTAAACGCTTACCCAG Locus tag: EAM_2770 Name: galR Funciton: galactose operon repressor galR
	EAM_2770	galR	galactose operon repressor galR
Position: -197 Score: 5.1 Sequence: CTATGTAATCGTTTTCAACA Position: -108 Score: 6.4 Sequence: TAGTGTAAACGATTCCATTT Locus tag: EAM_1197 Name: galT Funciton: galactose-1-phosphate uridylyltransferase Locus tag: EAM_1196 Name: galK Funciton: galactokinase Locus tag: EAM_1195 Name: galM Funciton: galactose-1-epimerase (mutarotase)
	EAM_1197	galT	galactose-1-phosphate uridylyltransferase
	EAM_1196	galK	galactokinase
	EAM_1195	galM	galactose-1-epimerase (mutarotase)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD