Regulon of GalR/GalS in Citrobacter koseri ATCC BAA-895

Properties
Regulator type:	Transcription factor
TF locus tag:	CKO_00640, CKO_04211
Regulator family:	LacI
Regulation mode:	repressor (activator)
Biological process:	Galactose utilization
Effector:	Galactose
Regulog:	GalR/GalS - Enterobacteriales
Statistics of regulated genes:
- Genes	17
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Galactose
By pathway - Galactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -124 Score: 4.9 Sequence: GCATGTAACCGTTTCCAGCC Locus tag: CKO_00640 Name: galS Funciton: galactose operon repressor galS
	CKO_00640	galS	galactose operon repressor galS
Position: -282 Score: 5.2 Sequence: TAATGAAACCGTTTACCCTC Position: -101 Score: 6.6 Sequence: TAGTGTAAACGATTACACTA Locus tag: CKO_04318 Name: galP Funciton: galactose transporter
	CKO_04318	galP	galactose transporter
Position: -287 Score: 5.5 Sequence: GGATGTAACCGCTTTCAATA Locus tag: CKO_00641 Name: mglB Funciton: beta-methylgalactoside ABC transporter, periplasmic binding protein Locus tag: CKO_00642 Name: mglA Funciton: beta-methylgalactoside ABC transporter, ATP-binding protein Locus tag: CKO_00643 Name: mglC Funciton: beta-methylgalactoside ABC transporter, inner membrane component
	CKO_00641	mglB	beta-methylgalactoside ABC transporter, periplasmic binding protein
	CKO_00642	mglA	beta-methylgalactoside ABC transporter, ATP-binding protein
	CKO_00643	mglC	beta-methylgalactoside ABC transporter, inner membrane component
Position: -148 Score: 4.7 Sequence: GAATGAAAGCGATTACAAAG Position: 0 Score: 4.6 Sequence: ATGTGGAAGCGCTTACTTTT Locus tag: CKO_03603 Name: ytfQ Funciton: periplasmic binding protein/LacI transcriptional regulator Locus tag: CKO_03602 Name: ytfR Funciton: putative sugar transport protein (ABC superfamily, atp_bind) Locus tag: CKO_03601 Name: ytfT Funciton: putative sugar transport protein (ABC superfamily, membrane) Locus tag: CKO_03600 Name: yjfF Funciton: inner membrane ABC transporter permease protein
	CKO_03603	ytfQ	periplasmic binding protein/LacI transcriptional regulator
	CKO_03602	ytfR	putative sugar transport protein (ABC superfamily, atp_bind)
	CKO_03601	ytfT	putative sugar transport protein (ABC superfamily, membrane)
	CKO_03600	yjfF	inner membrane ABC transporter permease protein
Position: -33 Score: 5.1 Sequence: AAATGTAAGCGTTTACCCAC Locus tag: CKO_04211 Name: galR Funciton: galactose operon repressor galR
	CKO_04211	galR	galactose operon repressor galR
Position: -70 Score: 5.1 Sequence: TTTTGTAATCGATTACTTTT Position: -38 Score: 4.9 Sequence: ATTTGTAATCGATTACTTTT Locus tag: CKO_02603 Name: ECA1400 Funciton: putative nucleoside H+ symporter Locus tag: CKO_02602 Name: ECA1399 Funciton: putative xylose isomerase-like TIM barrel Locus tag: CKO_02601 Name: ECA1398 Funciton: putative NADH-dependent dehydrogenase
	CKO_02603	ECA1400	putative nucleoside H+ symporter
	CKO_02602	ECA1399	putative xylose isomerase-like TIM barrel
	CKO_02601	ECA1398	putative NADH-dependent dehydrogenase
Position: -54 Score: 6.4 Sequence: AAGTGTAAACGATTCCACTA Locus tag: CKO_02376 Name: galE Funciton: UDP-galactose-4-epimerase Locus tag: CKO_02377 Name: galT Funciton: galactose-1-phosphate uridylyltransferase Locus tag: CKO_02378 Name: galK Funciton: galactokinase Locus tag: CKO_02379 Name: galM Funciton: galactose-1-epimerase (mutarotase)
	CKO_02376	galE	UDP-galactose-4-epimerase
	CKO_02377	galT	galactose-1-phosphate uridylyltransferase
	CKO_02378	galK	galactokinase
	CKO_02379	galM	galactose-1-epimerase (mutarotase)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of GalR/GalS in Citrobacter koseri ATCC BAA-895

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --