Regulon of GalR/GalS in Yersinia pestis KIM

Properties
Regulator type:	Transcription factor
TF locus tag:	y3183
Regulator family:	LacI
Regulation mode:	repressor (activator)
Biological process:	Galactose utilization
Effector:	Galactose
Regulog:	GalR/GalS - Enterobacteriales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 78 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Galactose
By pathway - Galactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: 32 Score: 5.4 Sequence: TGATGTAAGCGGTTACCCTA Locus tag: y3183 Name: galR Funciton: galactose operon repressor galR
	y3183	galR	galactose operon repressor galR
Position: -229 Score: 5.8 Sequence: TTGTGTAACCGGTTTCAATC Locus tag: y2662 Name: mglB Funciton: beta-methylgalactoside ABC transporter, periplasmic binding protein
	y2662	mglB	beta-methylgalactoside ABC transporter, periplasmic binding protein
Position: -95 Score: 6.4 Sequence: GAGTGTAAACGATTCCATTA Locus tag: y3043 Name: galE Funciton: UDP-galactose-4-epimerase Locus tag: y3044 Name: galT Funciton: galactose-1-phosphate uridylyltransferase Locus tag: y3045 Name: galK Funciton: galactokinase
	y3043	galE	UDP-galactose-4-epimerase
	y3044	galT	galactose-1-phosphate uridylyltransferase
	y3045	galK	galactokinase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD