Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulog Zur - Thermotogales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Thermotogae
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Thermotoga maritima MSB8 6 1
Thermotoga sp. RQ2 6 1
Thermotoga neapolitana DSM 4359 6 1
Thermotoga petrophila RKU-1 6 1
Thermotoga naphthophila RKU-10 6 1
Thermotoga lettingae TMO
Thermosipho africanus TCF52B 4 1
Thermosipho melanesiensis BI429 4 1
Fervidobacterium nodosum Rt17-B1 3 1
Petrotoga mobilis SJ95 4 1
Thermotogales bacterium TBF 19.5.1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
zur
*
Thermotoga maritima MSB8

Site:
position = -31
score = 7.03147
sequence = TTGCAAATGCTTTGCATTTGCAG

Gene: TM0122: Zinc uptake transcriptional regulator, Fur family
*
Thermotoga sp. RQ2

Site:
position = -31
score = 7.03147
sequence = TTGCAAATGCTTTGCATTTGCAG

Gene: TRQ2_0825: Zinc uptake transcriptional regulator, Fur family
*
Thermotoga neapolitana DSM 4359

Site:
position = -31
score = 7.03147
sequence = TTGCAAATGCTTTGCATTTGCAG

Gene: CTN_0567: Zinc uptake transcriptional regulator, Fur family
*
Thermotoga petrophila RKU-1

Site:
position = -31
score = 7.03147
sequence = TTGCAAATGCTTTGCATTTGCAG

Gene: Tpet_0802: Zinc uptake transcriptional regulator, Fur family
*
Thermotoga naphthophila RKU-10

Site:
position = -31
score = 7.03147
sequence = TTGCAAATGCTTTGCATTTGCAG

Gene: Tnap_0752: Zinc uptake transcriptional regulator, Fur family
 
Thermotoga lettingae TMO
*
Thermosipho africanus TCF52B

Site:
position = -42
score = 6.91067
sequence = ATGCAAATGATTTGCATTTGCAA

Gene: THA_725: Zinc uptake transcriptional regulator, Fur family
*
Thermosipho melanesiensis BI429

Site:
position = -37
score = 6.6698
sequence = ATGCAAATGATTTGCATTTTCAA

Gene: Tmel_0432: Zinc uptake transcriptional regulator, Fur family
 
Fervidobacterium nodosum Rt17-B1
*
Petrotoga mobilis SJ95

Site:
position = -97
score = 5.77684
sequence = ATGCTTATGCAAATCAGTTGCAA

Site:
position = -80
score = 5.79284
sequence = TTGCAAAAACAAATCGTTTGCAT

Gene: Pmob_0990: Zinc uptake transcriptional regulator, Fur family
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0150: Zinc uptake transcriptional regulator, Fur family
Zinc uptake transcriptional regulator, Fur family
znuA
 
Thermotoga maritima MSB8

Gene: TM0123: Zinc uptake ABC transport system, zinc-binding protein
 
Thermotoga sp. RQ2

Gene: TRQ2_0824: Zinc uptake ABC transport system, zinc-binding protein
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0566: Zinc uptake ABC transport system, zinc-binding protein
 
Thermotoga petrophila RKU-1

Gene: Tpet_0801: Zinc uptake ABC transport system, zinc-binding protein
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0753: Zinc uptake ABC transport system, zinc-binding protein
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B

Gene: THA_726: Zinc uptake ABC transport system, zinc-binding protein
 
Thermosipho melanesiensis BI429

Gene: Tmel_0433: Zinc uptake ABC transport system, zinc-binding protein
*
Fervidobacterium nodosum Rt17-B1

Site:
position = -460
score = 6.30814
sequence = ATGAAAATGATTTTCATTTTCAA

Gene: Fnod_0860: Zinc uptake ABC transport system, zinc-binding protein
 
Petrotoga mobilis SJ95

Gene: Pmob_0989: Zinc uptake ABC transport system, zinc-binding protein
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0149: Zinc uptake ABC transport system, zinc-binding protein
Zinc uptake ABC transport system, zinc-binding protein
znuC
 
Thermotoga maritima MSB8

Gene: TM0124: Zinc uptake ABC transport system, ATP-binding protein
 
Thermotoga sp. RQ2

Gene: TRQ2_0823: Zinc uptake ABC transport system, ATP-binding protein
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0565: Zinc uptake ABC transport system, ATP-binding protein
 
Thermotoga petrophila RKU-1

Gene: Tpet_0800: Zinc uptake ABC transport system, ATP-binding protein
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0754: Zinc uptake ABC transport system, ATP-binding protein
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B

Gene: THA_727: Zinc uptake ABC transport system, ATP-binding protein
 
Thermosipho melanesiensis BI429

Gene: Tmel_0434: Zinc uptake ABC transport system, ATP-binding protein
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_0859: Zinc uptake ABC transport system, ATP-binding protein
 
Petrotoga mobilis SJ95

Gene: Pmob_0988: Zinc uptake ABC transport system, ATP-binding protein
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0148: Zinc uptake ABC transport system, ATP-binding protein
Zinc uptake ABC transport system, ATP-binding protein
znuB
 
Thermotoga maritima MSB8

Gene: TM0125: Zinc uptake ABC transport system, permease protein
 
Thermotoga sp. RQ2

Gene: TRQ2_0822: Zinc uptake ABC transport system, permease protein
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0564: Zinc uptake ABC transport system, permease protein
 
Thermotoga petrophila RKU-1

Gene: Tpet_0799: Zinc uptake ABC transport system, permease protein
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0755: Zinc uptake ABC transport system, permease protein
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B

Gene: THA_728: Zinc uptake ABC transport system, permease protein
 
Thermosipho melanesiensis BI429

Gene: Tmel_0435: Zinc uptake ABC transport system, permease protein
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_0858: Zinc uptake ABC transport system, permease protein
 
Petrotoga mobilis SJ95

Gene: Pmob_0987: Zinc uptake ABC transport system, permease protein
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0147: Zinc uptake ABC transport system, permease protein
Zinc uptake ABC transport system, permease protein
znuR
 
Thermotoga maritima MSB8

Gene: TM0126: predicted zinc uptake two-component system response regulator, OmpR family
 
Thermotoga sp. RQ2

Gene: TRQ2_0821: predicted zinc uptake two-component system response regulator, OmpR family
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0563: predicted zinc uptake two-component system response regulator, OmpR family
 
Thermotoga petrophila RKU-1

Gene: Tpet_0798: predicted zinc uptake two-component system response regulator, OmpR family
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0756: predicted zinc uptake two-component system response regulator, OmpR family
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
predicted zinc uptake two-component system response regulator, OmpR family
znuS
 
Thermotoga maritima MSB8

Gene: TM0127: predicted zinc uptake two-component system histidine kinase
 
Thermotoga sp. RQ2

Gene: TRQ2_0820: predicted zinc uptake two-component system histidine kinase
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0562: predicted zinc uptake two-component system histidine kinase
 
Thermotoga petrophila RKU-1

Gene: Tpet_0797: predicted zinc uptake two-component system histidine kinase
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0757: predicted zinc uptake two-component system histidine kinase
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
predicted zinc uptake two-component system histidine kinase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD