Regulon of Zur in Thermotoga naphthophila RKU-10

Properties
Regulator type:	Transcription factor
TF locus tag:	Tnap_0752
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Thermotogales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -31 Score: 7 Sequence: TTGCAAATGCTTTGCATTTGCAG Locus tag: Tnap_0752 Name: zur Funciton: Zinc uptake transcriptional regulator, Fur family Locus tag: Tnap_0753 Name: znuA Funciton: Zinc uptake ABC transport system, zinc-binding protein Locus tag: Tnap_0754 Name: znuC Funciton: Zinc uptake ABC transport system, ATP-binding protein Locus tag: Tnap_0755 Name: znuB Funciton: Zinc uptake ABC transport system, permease protein Locus tag: Tnap_0756 Name: znuR Funciton: predicted zinc uptake two-component system response regulator, OmpR family Locus tag: Tnap_0757 Name: znuS Funciton: predicted zinc uptake two-component system histidine kinase
	Tnap_0752	zur	Zinc uptake transcriptional regulator, Fur family
	Tnap_0753	znuA	Zinc uptake ABC transport system, zinc-binding protein
	Tnap_0754	znuC	Zinc uptake ABC transport system, ATP-binding protein
	Tnap_0755	znuB	Zinc uptake ABC transport system, permease protein
	Tnap_0756	znuR	predicted zinc uptake two-component system response regulator, OmpR family
	Tnap_0757	znuS	predicted zinc uptake two-component system histidine kinase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD