Regulon of Zur in Thermosipho melanesiensis BI429

Properties
Regulator type:	Transcription factor
TF locus tag:	Tmel_0432
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Thermotogales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 6.7 Sequence: ATGCAAATGATTTGCATTTTCAA Locus tag: Tmel_0432 Name: zur Funciton: Zinc uptake transcriptional regulator, Fur family Locus tag: Tmel_0433 Name: znuA Funciton: Zinc uptake ABC transport system, zinc-binding protein Locus tag: Tmel_0434 Name: znuC Funciton: Zinc uptake ABC transport system, ATP-binding protein Locus tag: Tmel_0435 Name: znuB Funciton: Zinc uptake ABC transport system, permease protein
	Tmel_0432	zur	Zinc uptake transcriptional regulator, Fur family
	Tmel_0433	znuA	Zinc uptake ABC transport system, zinc-binding protein
	Tmel_0434	znuC	Zinc uptake ABC transport system, ATP-binding protein
	Tmel_0435	znuB	Zinc uptake ABC transport system, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD