Orthologous regulated operons containing znuS gene

Properties
Regulog:	Zur - Thermotogales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Thermotogae

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thermotoga maritima MSB8
Position: -31 Score: 7.03147 Sequence: TTGCAAATGCTTTGCATTTGCAG Locus tag: TM0122 Name: zur Funciton: Zinc uptake transcriptional regulator, Fur family Locus tag: TM0123 Name: znuA Funciton: Zinc uptake ABC transport system, zinc-binding protein Locus tag: TM0124 Name: znuC Funciton: Zinc uptake ABC transport system, ATP-binding protein Locus tag: TM0125 Name: znuB Funciton: Zinc uptake ABC transport system, permease protein Locus tag: TM0126 Name: znuR Funciton: predicted zinc uptake two-component system response regulator, OmpR family Locus tag: TM0127 Name: znuS Funciton: predicted zinc uptake two-component system histidine kinase
zur-znuA-znuC-znuB-znuR-znuS	-31	7	TTGCAAATGCTTTGCATTTGCAG	TM0122
Thermotoga naphthophila RKU-10
Position: -31 Score: 7.03147 Sequence: TTGCAAATGCTTTGCATTTGCAG Locus tag: Tnap_0752 Name: zur Funciton: Zinc uptake transcriptional regulator, Fur family Locus tag: Tnap_0753 Name: znuA Funciton: Zinc uptake ABC transport system, zinc-binding protein Locus tag: Tnap_0754 Name: znuC Funciton: Zinc uptake ABC transport system, ATP-binding protein Locus tag: Tnap_0755 Name: znuB Funciton: Zinc uptake ABC transport system, permease protein Locus tag: Tnap_0756 Name: znuR Funciton: predicted zinc uptake two-component system response regulator, OmpR family Locus tag: Tnap_0757 Name: znuS Funciton: predicted zinc uptake two-component system histidine kinase
zur-znuA-znuC-znuB-znuR-znuS	-31	7	TTGCAAATGCTTTGCATTTGCAG	Tnap_0752
Thermotoga neapolitana DSM 4359
Position: -31 Score: 7.03147 Sequence: TTGCAAATGCTTTGCATTTGCAG Locus tag: CTN_0567 Name: zur Funciton: Zinc uptake transcriptional regulator, Fur family Locus tag: CTN_0566 Name: znuA Funciton: Zinc uptake ABC transport system, zinc-binding protein Locus tag: CTN_0565 Name: znuC Funciton: Zinc uptake ABC transport system, ATP-binding protein Locus tag: CTN_0564 Name: znuB Funciton: Zinc uptake ABC transport system, permease protein Locus tag: CTN_0563 Name: znuR Funciton: predicted zinc uptake two-component system response regulator, OmpR family Locus tag: CTN_0562 Name: znuS Funciton: predicted zinc uptake two-component system histidine kinase
zur-znuA-znuC-znuB-znuR-znuS	-31	7	TTGCAAATGCTTTGCATTTGCAG	CTN_0567
Thermotoga petrophila RKU-1
Position: -31 Score: 7.03147 Sequence: TTGCAAATGCTTTGCATTTGCAG Locus tag: Tpet_0802 Name: zur Funciton: Zinc uptake transcriptional regulator, Fur family Locus tag: Tpet_0801 Name: znuA Funciton: Zinc uptake ABC transport system, zinc-binding protein Locus tag: Tpet_0800 Name: znuC Funciton: Zinc uptake ABC transport system, ATP-binding protein Locus tag: Tpet_0799 Name: znuB Funciton: Zinc uptake ABC transport system, permease protein Locus tag: Tpet_0798 Name: znuR Funciton: predicted zinc uptake two-component system response regulator, OmpR family Locus tag: Tpet_0797 Name: znuS Funciton: predicted zinc uptake two-component system histidine kinase
zur-znuA-znuC-znuB-znuR-znuS	-31	7	TTGCAAATGCTTTGCATTTGCAG	Tpet_0802
Thermotoga sp. RQ2
Position: -31 Score: 7.03147 Sequence: TTGCAAATGCTTTGCATTTGCAG Locus tag: TRQ2_0825 Name: zur Funciton: Zinc uptake transcriptional regulator, Fur family Locus tag: TRQ2_0824 Name: znuA Funciton: Zinc uptake ABC transport system, zinc-binding protein Locus tag: TRQ2_0823 Name: znuC Funciton: Zinc uptake ABC transport system, ATP-binding protein Locus tag: TRQ2_0822 Name: znuB Funciton: Zinc uptake ABC transport system, permease protein Locus tag: TRQ2_0821 Name: znuR Funciton: predicted zinc uptake two-component system response regulator, OmpR family Locus tag: TRQ2_0820 Name: znuS Funciton: predicted zinc uptake two-component system histidine kinase
zur-znuA-znuC-znuB-znuR-znuS	-31	7	TTGCAAATGCTTTGCATTTGCAG	TRQ2_0825