Regulon of Zur in Thermosipho africanus TCF52B

Properties
Regulator type:	Transcription factor
TF locus tag:	THA_725
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Thermotogales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -42 Score: 6.9 Sequence: ATGCAAATGATTTGCATTTGCAA Locus tag: THA_725 Name: zur Funciton: Zinc uptake transcriptional regulator, Fur family Locus tag: THA_726 Name: znuA Funciton: Zinc uptake ABC transport system, zinc-binding protein Locus tag: THA_727 Name: znuC Funciton: Zinc uptake ABC transport system, ATP-binding protein Locus tag: THA_728 Name: znuB Funciton: Zinc uptake ABC transport system, permease protein
	THA_725	zur	Zinc uptake transcriptional regulator, Fur family
	THA_726	znuA	Zinc uptake ABC transport system, zinc-binding protein
	THA_727	znuC	Zinc uptake ABC transport system, ATP-binding protein
	THA_728	znuB	Zinc uptake ABC transport system, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD