Regulon of Zur in Fervidobacterium nodosum Rt17-B1
| Regulator type: | Transcription factor |
| TF locus tag: | |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Regulog: | Zur - Thermotogales |
| Statistics of regulated genes: | |
| - Genes | 3 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermotogales
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -460
Score: 6.3 Sequence: ATGAAAATGATTTTCATTTTCAA
Locus tag: Fnod_0860
Name: znuA Funciton: Zinc uptake ABC transport system, zinc-binding protein
Locus tag: Fnod_0859
Name: znuC Funciton: Zinc uptake ABC transport system, ATP-binding protein
Locus tag: Fnod_0858
Name: znuB Funciton: Zinc uptake ABC transport system, permease protein |
|||
|
znuA
|
Zinc uptake ABC transport system, zinc-binding protein
|
||
|
znuC
|
Zinc uptake ABC transport system, ATP-binding protein
|
||
|
znuB
|
Zinc uptake ABC transport system, permease protein
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |