Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulon of Zur in Thermotoga petrophila RKU-1

Properties
Regulator type: Transcription factor
TF locus tag: Tpet_0802
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Thermotogales
Statistics of regulated genes:
- Genes 6
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -31
Score: 7
Sequence: TTGCAAATGCTTTGCATTTGCAG
Locus tag: Tpet_0802
Name: zur
Funciton: Zinc uptake transcriptional regulator, Fur family
Locus tag: Tpet_0801
Name: znuA
Funciton: Zinc uptake ABC transport system, zinc-binding protein
Locus tag: Tpet_0800
Name: znuC
Funciton: Zinc uptake ABC transport system, ATP-binding protein
Locus tag: Tpet_0799
Name: znuB
Funciton: Zinc uptake ABC transport system, permease protein
Locus tag: Tpet_0798
Name: znuR
Funciton: predicted zinc uptake two-component system response regulator, OmpR family
Locus tag: Tpet_0797
Name: znuS
Funciton: predicted zinc uptake two-component system histidine kinase
zur
Zinc uptake transcriptional regulator, Fur family
znuA
Zinc uptake ABC transport system, zinc-binding protein
znuC
Zinc uptake ABC transport system, ATP-binding protein
znuB
Zinc uptake ABC transport system, permease protein
znuR
predicted zinc uptake two-component system response regulator, OmpR family
znuS
predicted zinc uptake two-component system histidine kinase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD