Regulog UgpR - Thermotogales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Possibly alpha-mannosides utilization
Effector:
Phylum:	Thermotogae
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - LacI
By pathway - Possibly alpha-mannosides utilization

Statistics of regulated genes
Genome	Genes	Operons
Thermotoga maritima MSB8	6	1
Thermotoga sp. RQ2
Thermotoga neapolitana DSM 4359	6	1
Thermotoga petrophila RKU-1	8	1
Thermotoga naphthophila RKU-10	8	1
Thermotoga lettingae TMO	5	1
Thermosipho africanus TCF52B	2	1
Thermosipho melanesiensis BI429	3	1
Fervidobacterium nodosum Rt17-B1
Petrotoga mobilis SJ95
Thermotogales bacterium TBF 19.5.1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
ugpR	* Thermotoga maritima MSB8 Site: position = -30 score = 6.53723 sequence = ATATGTAAGCGCTTACAGGA Gene: TM1856: Predicted regulator of alpha-mannoside utilization, LacI family	Thermotoga sp. RQ2	* Thermotoga neapolitana DSM 4359 Site: position = -30 score = 6.23778 sequence = TTATGTAAGCGCTTACAGGA Gene: CTN_0791: Predicted regulator of alpha-mannoside utilization, LacI family	* Thermotoga petrophila RKU-1 Site: position = -30 score = 6.53723 sequence = ATATGTAAGCGCTTACAGGA Gene: Tpet_0941: Predicted regulator of alpha-mannoside utilization, LacI family	* Thermotoga naphthophila RKU-10 Site: position = -30 score = 6.53723 sequence = ATATGTAAGCGCTTACAGGA Gene: Tnap_0613: Predicted regulator of alpha-mannoside utilization, LacI family	* Thermotoga lettingae TMO Site: position = -32 score = 5.93414 sequence = ATATGAAAAGGATTACACAA Site: position = -208 score = 5.92099 sequence = TTATGGAAACGATTACATAT Gene: Tlet_1033: Predicted regulator of alpha-mannoside utilization, LacI family	Thermosipho africanus TCF52B Gene: THA_1966: Predicted regulator of alpha-mannoside utilization, LacI family	* Thermosipho melanesiensis BI429 Site: position = -34 score = 6.22045 sequence = AATTGTAAACGCTTACAAAG Gene: Tmel_0763: Predicted regulator of alpha-mannoside utilization, LacI family	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted regulator of alpha-mannoside utilization, LacI family
ugpE	Thermotoga maritima MSB8 Gene: TM1855: Predicted alpha-mannoside ABC transporter, substrate binding protein	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_0790: Predicted alpha-mannoside ABC transporter, substrate binding protein	Thermotoga petrophila RKU-1 Gene: Tpet_0942: Predicted alpha-mannoside ABC transporter, substrate binding protein	Thermotoga naphthophila RKU-10 Gene: Tnap_0612: Predicted alpha-mannoside ABC transporter, substrate binding protein	Thermotoga lettingae TMO Gene: Tlet_1032: Predicted alpha-mannoside ABC transporter, substrate binding protein	* Thermosipho africanus TCF52B Site: position = -172 score = 6.18331 sequence = ATATGTAAGCGTTTACAAAA Site: position = -36 score = 6.3064 sequence = TAATGTAAACGCTTACAAAA Gene: THA_1964: Predicted alpha-mannoside ABC transporter, substrate binding protein	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted alpha-mannoside ABC transporter, substrate binding protein
Tpet_0943	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1 Gene: Tpet_0943: conserved hypothetical protein	Thermotoga naphthophila RKU-10 Gene: Tnap_0611: conserved hypothetical protein	Thermotoga lettingae TMO	Thermosipho africanus TCF52B Gene: THA_1965: conserved hypothetical protein	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	conserved hypothetical protein
Tpet_0944	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1 Gene: Tpet_0944: glycosyl transferase group 1	Thermotoga naphthophila RKU-10 Gene: Tnap_0610: glycosyl transferase group 1	Thermotoga lettingae TMO	Thermosipho africanus TCF52B Gene: THA_1971: glycosyl transferase group 1	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	glycosyl transferase group 1
ugpF	Thermotoga maritima MSB8 Gene: TM1854: Predicted alpha-mannoside ABC transporter, permease protein 1	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_0789: Predicted alpha-mannoside ABC transporter, permease protein 1	Thermotoga petrophila RKU-1 Gene: Tpet_0945: Predicted alpha-mannoside ABC transporter, permease protein 1	Thermotoga naphthophila RKU-10 Gene: Tnap_0609: Predicted alpha-mannoside ABC transporter, permease protein 1	Thermotoga lettingae TMO Gene: Tlet_1031: Predicted alpha-mannoside ABC transporter, permease protein 1	Thermosipho africanus TCF52B Gene: THA_1967: Predicted alpha-mannoside ABC transporter, permease protein 1	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted alpha-mannoside ABC transporter, permease protein 1
ugpG	Thermotoga maritima MSB8 Gene: TM1853: Predicted alpha-mannoside ABC transporter, permease protein 2	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_0788: Predicted alpha-mannoside ABC transporter, permease protein 2	Thermotoga petrophila RKU-1 Gene: Tpet_0946: Predicted alpha-mannoside ABC transporter, permease protein 2	Thermotoga naphthophila RKU-10 Gene: Tnap_0608: Predicted alpha-mannoside ABC transporter, permease protein 2	Thermotoga lettingae TMO Gene: Tlet_1030: Predicted alpha-mannoside ABC transporter, permease protein 2	Thermosipho africanus TCF52B Gene: THA_1968: Predicted alpha-mannoside ABC transporter, permease protein 2	Thermosipho melanesiensis BI429	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted alpha-mannoside ABC transporter, permease protein 2
TM1852	Thermotoga maritima MSB8 Gene: TM1852: Predicted glycosylase, COG2152	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359 Gene: CTN_0787: Predicted glycosylase, COG2152	Thermotoga petrophila RKU-1 Gene: Tpet_0947: Predicted glycosylase, COG2152	Thermotoga naphthophila RKU-10 Gene: Tnap_0607: Predicted glycosylase, COG2152	Thermotoga lettingae TMO Gene: Tlet_1029: Predicted glycosylase, COG2152	Thermosipho africanus TCF52B Gene: THA_1969: Predicted glycosylase, COG2152	Thermosipho melanesiensis BI429 Gene: Tmel_0764: Predicted glycosylase, COG2152	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Predicted glycosylase, COG2152
mnnA	Thermotoga maritima MSB8 Gene: TM1851: Alpha-mannosidase (EC 3.2.1.24)	Thermotoga sp. RQ2 Gene: TRQ2_0965: Alpha-mannosidase (EC 3.2.1.24)	Thermotoga neapolitana DSM 4359 Gene: CTN_0786: Alpha-mannosidase (EC 3.2.1.24)	Thermotoga petrophila RKU-1 Gene: Tpet_0948: Alpha-mannosidase (EC 3.2.1.24)	Thermotoga naphthophila RKU-10 Gene: Tnap_0606: Alpha-mannosidase (EC 3.2.1.24)	Thermotoga lettingae TMO Gene: Tlet_0117: Alpha-mannosidase (EC 3.2.1.24)	Thermosipho africanus TCF52B Gene: THA_1290: Alpha-mannosidase (EC 3.2.1.24)	Thermosipho melanesiensis BI429 Gene: Tmel_1011: Alpha-mannosidase (EC 3.2.1.24)	Fervidobacterium nodosum Rt17-B1 Gene: Fnod_0811: Alpha-mannosidase (EC 3.2.1.24)	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Alpha-mannosidase (EC 3.2.1.24)
aglA	Thermotoga maritima MSB8	Thermotoga sp. RQ2	Thermotoga neapolitana DSM 4359	Thermotoga petrophila RKU-1	Thermotoga naphthophila RKU-10	Thermotoga lettingae TMO	Thermosipho africanus TCF52B Gene: THA_1970: Maltodextrin glucosidase (EC 3.2.1.20)	Thermosipho melanesiensis BI429 Gene: Tmel_0765: Maltodextrin glucosidase (EC 3.2.1.20)	Fervidobacterium nodosum Rt17-B1	Petrotoga mobilis SJ95	Thermotogales bacterium TBF 19.5.1	Maltodextrin glucosidase (EC 3.2.1.20)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog UgpR - Thermotogales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --