Regulog UgpR - Thermotogales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Possibly alpha-mannosides utilization |
| Effector: | |
| Phylum: | Thermotogae |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermotogales
- By TF family - LacI
- By pathway - Possibly alpha-mannosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Thermotoga maritima MSB8 | 6 | 1 |
| Thermotoga sp. RQ2 | ||
| Thermotoga neapolitana DSM 4359 | 6 | 1 |
| Thermotoga petrophila RKU-1 | 8 | 1 |
| Thermotoga naphthophila RKU-10 | 8 | 1 |
| Thermotoga lettingae TMO | 5 | 1 |
| Thermosipho africanus TCF52B | 2 | 1 |
| Thermosipho melanesiensis BI429 | 3 | 1 |
| Fervidobacterium nodosum Rt17-B1 | ||
| Petrotoga mobilis SJ95 | ||
| Thermotogales bacterium TBF 19.5.1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| ugpR |
*
Thermotoga maritima MSB8 Site: position = -30 score = 6.53723 sequence = ATATGTAAGCGCTTACAGGA Gene: TM1856: Predicted regulator of alpha-mannoside utilization, LacI family |
|
*
Thermotoga neapolitana DSM 4359 Site: position = -30 score = 6.23778 sequence = TTATGTAAGCGCTTACAGGA Gene: CTN_0791: Predicted regulator of alpha-mannoside utilization, LacI family |
*
Thermotoga petrophila RKU-1 Site: position = -30 score = 6.53723 sequence = ATATGTAAGCGCTTACAGGA Gene: Tpet_0941: Predicted regulator of alpha-mannoside utilization, LacI family |
*
Thermotoga naphthophila RKU-10 Site: position = -30 score = 6.53723 sequence = ATATGTAAGCGCTTACAGGA Gene: Tnap_0613: Predicted regulator of alpha-mannoside utilization, LacI family |
*
Thermotoga lettingae TMO Site: position = -32 score = 5.93414 sequence = ATATGAAAAGGATTACACAA Site: position = -208 score = 5.92099 sequence = TTATGGAAACGATTACATAT Gene: Tlet_1033: Predicted regulator of alpha-mannoside utilization, LacI family |
Gene: THA_1966: Predicted regulator of alpha-mannoside utilization, LacI family |
*
Thermosipho melanesiensis BI429 Site: position = -34 score = 6.22045 sequence = AATTGTAAACGCTTACAAAG Gene: Tmel_0763: Predicted regulator of alpha-mannoside utilization, LacI family |
|
|
|
Predicted regulator of alpha-mannoside utilization, LacI family |
| ugpE |
Gene: TM1855: Predicted alpha-mannoside ABC transporter, substrate binding protein |
|
Gene: CTN_0790: Predicted alpha-mannoside ABC transporter, substrate binding protein |
Gene: Tpet_0942: Predicted alpha-mannoside ABC transporter, substrate binding protein |
Gene: Tnap_0612: Predicted alpha-mannoside ABC transporter, substrate binding protein |
Gene: Tlet_1032: Predicted alpha-mannoside ABC transporter, substrate binding protein |
*
Thermosipho africanus TCF52B Site: position = -172 score = 6.18331 sequence = ATATGTAAGCGTTTACAAAA Site: position = -36 score = 6.3064 sequence = TAATGTAAACGCTTACAAAA Gene: THA_1964: Predicted alpha-mannoside ABC transporter, substrate binding protein |
|
|
|
|
Predicted alpha-mannoside ABC transporter, substrate binding protein |
| Tpet_0943 |
|
|
|
Gene: Tpet_0943: conserved hypothetical protein |
Gene: Tnap_0611: conserved hypothetical protein |
|
Gene: THA_1965: conserved hypothetical protein |
|
|
|
|
conserved hypothetical protein |
| Tpet_0944 |
|
|
|
Gene: Tpet_0944: glycosyl transferase group 1 |
Gene: Tnap_0610: glycosyl transferase group 1 |
|
Gene: THA_1971: glycosyl transferase group 1 |
|
|
|
|
glycosyl transferase group 1 |
| ugpF |
Gene: TM1854: Predicted alpha-mannoside ABC transporter, permease protein 1 |
|
Gene: CTN_0789: Predicted alpha-mannoside ABC transporter, permease protein 1 |
Gene: Tpet_0945: Predicted alpha-mannoside ABC transporter, permease protein 1 |
Gene: Tnap_0609: Predicted alpha-mannoside ABC transporter, permease protein 1 |
Gene: Tlet_1031: Predicted alpha-mannoside ABC transporter, permease protein 1 |
Gene: THA_1967: Predicted alpha-mannoside ABC transporter, permease protein 1 |
|
|
|
|
Predicted alpha-mannoside ABC transporter, permease protein 1 |
| ugpG |
Gene: TM1853: Predicted alpha-mannoside ABC transporter, permease protein 2 |
|
Gene: CTN_0788: Predicted alpha-mannoside ABC transporter, permease protein 2 |
Gene: Tpet_0946: Predicted alpha-mannoside ABC transporter, permease protein 2 |
Gene: Tnap_0608: Predicted alpha-mannoside ABC transporter, permease protein 2 |
Gene: Tlet_1030: Predicted alpha-mannoside ABC transporter, permease protein 2 |
Gene: THA_1968: Predicted alpha-mannoside ABC transporter, permease protein 2 |
|
|
|
|
Predicted alpha-mannoside ABC transporter, permease protein 2 |
| TM1852 |
Gene: TM1852: Predicted glycosylase, COG2152 |
|
Gene: CTN_0787: Predicted glycosylase, COG2152 |
Gene: Tpet_0947: Predicted glycosylase, COG2152 |
Gene: Tnap_0607: Predicted glycosylase, COG2152 |
Gene: Tlet_1029: Predicted glycosylase, COG2152 |
Gene: THA_1969: Predicted glycosylase, COG2152 |
Gene: Tmel_0764: Predicted glycosylase, COG2152 |
|
|
|
Predicted glycosylase, COG2152 |
| mnnA |
Gene: TM1851: Alpha-mannosidase (EC 3.2.1.24) |
Gene: TRQ2_0965: Alpha-mannosidase (EC 3.2.1.24) |
Gene: CTN_0786: Alpha-mannosidase (EC 3.2.1.24) |
Gene: Tpet_0948: Alpha-mannosidase (EC 3.2.1.24) |
Gene: Tnap_0606: Alpha-mannosidase (EC 3.2.1.24) |
Gene: Tlet_0117: Alpha-mannosidase (EC 3.2.1.24) |
Gene: THA_1290: Alpha-mannosidase (EC 3.2.1.24) |
Gene: Tmel_1011: Alpha-mannosidase (EC 3.2.1.24) |
Gene: Fnod_0811: Alpha-mannosidase (EC 3.2.1.24) |
|
|
Alpha-mannosidase (EC 3.2.1.24) |
| aglA |
|
|
|
|
|
|
Gene: THA_1970: Maltodextrin glucosidase (EC 3.2.1.20) |
Gene: Tmel_0765: Maltodextrin glucosidase (EC 3.2.1.20) |
|
|
|
Maltodextrin glucosidase (EC 3.2.1.20) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |