Regulon of UgpR in Thermotoga naphthophila RKU-10

Properties
Regulator type:	Transcription factor
TF locus tag:	Tnap_0613
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Possibly alpha-mannosides utilization
Effector:
Regulog:	UgpR - Thermotogales
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - LacI
By pathway - Possibly alpha-mannosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -30 Score: 6.5 Sequence: ATATGTAAGCGCTTACAGGA Locus tag: Tnap_0613 Name: ugpR Funciton: Predicted regulator of alpha-mannoside utilization, LacI family Locus tag: Tnap_0612 Name: ugpE Funciton: Predicted alpha-mannoside ABC transporter, substrate binding protein Locus tag: Tnap_0611 Name: Tpet_0943 Funciton: conserved hypothetical protein Locus tag: Tnap_0610 Name: Tpet_0944 Funciton: glycosyl transferase group 1 Locus tag: Tnap_0609 Name: ugpF Funciton: Predicted alpha-mannoside ABC transporter, permease protein 1 Locus tag: Tnap_0608 Name: ugpG Funciton: Predicted alpha-mannoside ABC transporter, permease protein 2 Locus tag: Tnap_0607 Name: TM1852 Funciton: Predicted glycosylase, COG2152 Locus tag: Tnap_0606 Name: mnnA Funciton: Alpha-mannosidase (EC 3.2.1.24)
	Tnap_0613	ugpR	Predicted regulator of alpha-mannoside utilization, LacI family
	Tnap_0612	ugpE	Predicted alpha-mannoside ABC transporter, substrate binding protein
	Tnap_0611	Tpet_0943	conserved hypothetical protein
	Tnap_0610	Tpet_0944	glycosyl transferase group 1
	Tnap_0609	ugpF	Predicted alpha-mannoside ABC transporter, permease protein 1
	Tnap_0608	ugpG	Predicted alpha-mannoside ABC transporter, permease protein 2
	Tnap_0607	TM1852	Predicted glycosylase, COG2152
	Tnap_0606	mnnA	Alpha-mannosidase (EC 3.2.1.24)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD