Regulon of UgpR in Thermosipho melanesiensis BI429

Properties
Regulator type:	Transcription factor
TF locus tag:	Tmel_0763
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Possibly alpha-mannosides utilization
Effector:
Regulog:	UgpR - Thermotogales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - LacI
By pathway - Possibly alpha-mannosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -34 Score: 6.2 Sequence: AATTGTAAACGCTTACAAAG Locus tag: Tmel_0763 Name: ugpR Funciton: Predicted regulator of alpha-mannoside utilization, LacI family Locus tag: Tmel_0764 Name: TM1852 Funciton: Predicted glycosylase, COG2152 Locus tag: Tmel_0765 Name: aglA Funciton: Maltodextrin glucosidase (EC 3.2.1.20)
	Tmel_0763	ugpR	Predicted regulator of alpha-mannoside utilization, LacI family
	Tmel_0764	TM1852	Predicted glycosylase, COG2152
	Tmel_0765	aglA	Maltodextrin glucosidase (EC 3.2.1.20)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD