Regulon of UgpR in Thermotoga maritima MSB8

Properties
Regulator type:	Transcription factor
TF locus tag:	TM1856
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Possibly alpha-mannosides utilization
Effector:
Regulog:	UgpR - Thermotogales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - LacI
By pathway - Possibly alpha-mannosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -30 Score: 6.5 Sequence: ATATGTAAGCGCTTACAGGA Locus tag: TM1856 Name: ugpR Funciton: Predicted regulator of alpha-mannoside utilization, LacI family Locus tag: TM1855 Name: ugpE Funciton: Predicted alpha-mannoside ABC transporter, substrate binding protein Locus tag: TM1854 Name: ugpF Funciton: Predicted alpha-mannoside ABC transporter, permease protein 1 Locus tag: TM1853 Name: ugpG Funciton: Predicted alpha-mannoside ABC transporter, permease protein 2 Locus tag: TM1852 Name: TM1852 Funciton: Predicted glycosylase, COG2152 Locus tag: TM1851 Name: mnnA Funciton: Alpha-mannosidase (EC 3.2.1.24)
	TM1856	ugpR	Predicted regulator of alpha-mannoside utilization, LacI family
	TM1855	ugpE	Predicted alpha-mannoside ABC transporter, substrate binding protein
	TM1854	ugpF	Predicted alpha-mannoside ABC transporter, permease protein 1
	TM1853	ugpG	Predicted alpha-mannoside ABC transporter, permease protein 2
	TM1852	TM1852	Predicted glycosylase, COG2152
	TM1851	mnnA	Alpha-mannosidase (EC 3.2.1.24)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD