Orthologous regulated operons containing aglA gene

Properties
Regulog:	UgpR - Thermotogales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Possibly alpha-mannosides utilization
Effector:
Phylum:	Thermotogae

Built upon 9 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thermosipho melanesiensis BI429
Position: -34 Score: 6.22045 Sequence: AATTGTAAACGCTTACAAAG Locus tag: Tmel_0763 Name: ugpR Funciton: Predicted regulator of alpha-mannoside utilization, LacI family Locus tag: Tmel_0764 Name: TM1852 Funciton: Predicted glycosylase, COG2152 Locus tag: Tmel_0765 Name: aglA Funciton: Maltodextrin glucosidase (EC 3.2.1.20)
ugpR-TM1852-aglA	-34	6.2	AATTGTAAACGCTTACAAAG	Tmel_0763

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --