Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Tpet_0943 gene

Properties
Regulog: UgpR - Thermotogales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Possibly alpha-mannosides utilization
Effector:
Phylum: Thermotogae
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermosipho africanus TCF52B
Position: -172
Score: 6.18331
Sequence: ATATGTAAGCGTTTACAAAA
Position: -36
Score: 6.3064
Sequence: TAATGTAAACGCTTACAAAA
Locus tag: THA_1964
Name: ugpE
Funciton: Predicted alpha-mannoside ABC transporter, substrate binding protein
Locus tag: THA_1965
Name: Tpet_0943
Funciton: conserved hypothetical protein
ugpE-Tpet_0943 -172 6.2 ATATGTAAGCGTTTACAAAA THA_1964
-36 6.3 TAATGTAAACGCTTACAAAA
Thermotoga naphthophila RKU-10
Position: -30
Score: 6.53723
Sequence: ATATGTAAGCGCTTACAGGA
Locus tag: Tnap_0613
Name: ugpR
Funciton: Predicted regulator of alpha-mannoside utilization, LacI family
Locus tag: Tnap_0612
Name: ugpE
Funciton: Predicted alpha-mannoside ABC transporter, substrate binding protein
Locus tag: Tnap_0611
Name: Tpet_0943
Funciton: conserved hypothetical protein
Locus tag: Tnap_0610
Name: Tpet_0944
Funciton: glycosyl transferase group 1
Locus tag: Tnap_0609
Name: ugpF
Funciton: Predicted alpha-mannoside ABC transporter, permease protein 1
Locus tag: Tnap_0608
Name: ugpG
Funciton: Predicted alpha-mannoside ABC transporter, permease protein 2
Locus tag: Tnap_0607
Name: TM1852
Funciton: Predicted glycosylase, COG2152
Locus tag: Tnap_0606
Name: mnnA
Funciton: Alpha-mannosidase (EC 3.2.1.24)
ugpR-ugpE-Tpet_0943-Tpet_0944-ugpF-ugpG-TM1852-mnnA -30 6.5 ATATGTAAGCGCTTACAGGA Tnap_0613
Thermotoga petrophila RKU-1
Position: -30
Score: 6.53723
Sequence: ATATGTAAGCGCTTACAGGA
Locus tag: Tpet_0941
Name: ugpR
Funciton: Predicted regulator of alpha-mannoside utilization, LacI family
Locus tag: Tpet_0942
Name: ugpE
Funciton: Predicted alpha-mannoside ABC transporter, substrate binding protein
Locus tag: Tpet_0943
Name: Tpet_0943
Funciton: conserved hypothetical protein
Locus tag: Tpet_0944
Name: Tpet_0944
Funciton: glycosyl transferase group 1
Locus tag: Tpet_0945
Name: ugpF
Funciton: Predicted alpha-mannoside ABC transporter, permease protein 1
Locus tag: Tpet_0946
Name: ugpG
Funciton: Predicted alpha-mannoside ABC transporter, permease protein 2
Locus tag: Tpet_0947
Name: TM1852
Funciton: Predicted glycosylase, COG2152
Locus tag: Tpet_0948
Name: mnnA
Funciton: Alpha-mannosidase (EC 3.2.1.24)
ugpR-ugpE-Tpet_0943-Tpet_0944-ugpF-ugpG-TM1852-mnnA -30 6.5 ATATGTAAGCGCTTACAGGA Tpet_0941