Regulon of UgpR in Thermotoga lettingae TMO

Properties
Regulator type:	Transcription factor
TF locus tag:	Tlet_1033
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Possibly alpha-mannosides utilization
Effector:
Regulog:	UgpR - Thermotogales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - LacI
By pathway - Possibly alpha-mannosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -208 Score: 5.9 Sequence: TTATGGAAACGATTACATAT Position: -32 Score: 5.9 Sequence: ATATGAAAAGGATTACACAA Locus tag: Tlet_1033 Name: ugpR Funciton: Predicted regulator of alpha-mannoside utilization, LacI family Locus tag: Tlet_1032 Name: ugpE Funciton: Predicted alpha-mannoside ABC transporter, substrate binding protein Locus tag: Tlet_1031 Name: ugpF Funciton: Predicted alpha-mannoside ABC transporter, permease protein 1 Locus tag: Tlet_1030 Name: ugpG Funciton: Predicted alpha-mannoside ABC transporter, permease protein 2 Locus tag: Tlet_1029 Name: TM1852 Funciton: Predicted glycosylase, COG2152
	Tlet_1033	ugpR	Predicted regulator of alpha-mannoside utilization, LacI family
	Tlet_1032	ugpE	Predicted alpha-mannoside ABC transporter, substrate binding protein
	Tlet_1031	ugpF	Predicted alpha-mannoside ABC transporter, permease protein 1
	Tlet_1030	ugpG	Predicted alpha-mannoside ABC transporter, permease protein 2
	Tlet_1029	TM1852	Predicted glycosylase, COG2152

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD