Regulon of UgpR in Thermosipho africanus TCF52B

Properties
Regulator type:	Transcription factor
TF locus tag:	THA_1966
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Possibly alpha-mannosides utilization
Effector:
Regulog:	UgpR - Thermotogales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Thermotogales
By TF family - LacI
By pathway - Possibly alpha-mannosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -172 Score: 6.2 Sequence: ATATGTAAGCGTTTACAAAA Position: -36 Score: 6.3 Sequence: TAATGTAAACGCTTACAAAA Locus tag: THA_1964 Name: ugpE Funciton: Predicted alpha-mannoside ABC transporter, substrate binding protein Locus tag: THA_1965 Name: Tpet_0943 Funciton: conserved hypothetical protein
	THA_1964	ugpE	Predicted alpha-mannoside ABC transporter, substrate binding protein
	THA_1965	Tpet_0943	conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD