Regulog Zur - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By trascription factor - Zur
- By TF family - FUR
- By effector - Zinc ion, (Zn2+)
- By pathway - Zinc homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium adolescentis ATCC 15703 | 4 | 3 |
| Bifidobacterium angulatum DSM 20098 | 4 | 3 |
| Bifidobacterium animalis subsp. lactis AD011 | 4 | 3 |
| Bifidobacterium bifidum NCIMB 41171 | 5 | 4 |
| Bifidobacterium breve DSM 20213 | 6 | 5 |
| Bifidobacterium dentium Bd1 | 10 | 4 |
| Bifidobacterium gallicum DSM 20093 | 3 | 2 |
| Bifidobacterium longum NCC2705 | 2 | 2 |
| Bifidobacterium longum subsp. infantis ATCC 15697 | 7 | 5 |
| Gardnerella vaginalis 409-05 | 6 | 1 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| rpmB2 |
|
|
|
*
Bifidobacterium bifidum NCIMB 41171 Site: position = 14 score = 5.57917 sequence = TTTTGATAATGATTATCATTA Gene: BbifN4_010100006411: LSU ribosomal protein L28p |
|
*
Bifidobacterium dentium Bd1 Site: position = -37 score = 6.14112 sequence = TATTGATAATGATTATCATTA Gene: BDP_1883: LSU ribosomal protein L28p |
|
|
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -37 score = 5.22909 sequence = ATTTGATAATGGTTATCATTA Gene: Blon_1965: LSU ribosomal protein L28p |
|
LSU ribosomal protein L28p |
| rpmG2 |
|
|
|
|
|
Gene: BDP_1882: LSU ribosomal protein L33p |
|
|
Gene: Blon_1966: LSU ribosomal protein L33p |
|
LSU ribosomal protein L33p |
| rpsN2 |
|
|
|
|
*
Bifidobacterium breve DSM 20213 Site: position = -19 score = 5.71551 sequence = TATTGAGAATTATTATCATTT Gene: BIFBRE_00822: SSU ribosomal protein S14p |
Gene: BDP_1881: SSU ribosomal protein S14p |
|
|
|
|
SSU ribosomal protein S14p |
| rpmJ2 |
|
|
|
|
|
Gene: BDP_1879: LSU ribosomal protein L36p |
|
|
|
|
LSU ribosomal protein L36p |
| BDP_1880 |
|
|
|
|
|
Gene: BDP_1880: hypothetical protein |
|
|
|
|
hypothetical protein |
| zinT |
|
|
*
Bifidobacterium animalis subsp. lactis AD011 Site: position = -60 score = 5.99025 sequence = TATTGAGAACGATTCCCAATA Site: position = -92 score = 6.23234 sequence = TATTGAGAATCGTTCTCATTT Gene: BLA_0171: Candidate zinc-binding lipoprotein ZinT |
|
|
Gene: BDP_1878: Candidate zinc-binding lipoprotein ZinT |
|
|
|
|
Candidate zinc-binding lipoprotein ZinT |
| CRON 2. | |||||||||||
| zur |
Gene: BAD_0517: Zinc uptake regulation protein ZUR |
Gene: BIFANG_00962: Zinc uptake regulation protein ZUR |
Gene: BLA_1123: Zinc uptake regulation protein ZUR |
Gene: BbifN4_010100006451: Zinc uptake regulation protein ZUR |
*2
Bifidobacterium breve DSM 20213 Site: position = -45 score = 5.08654 sequence = TAACGATAATGAATATCATTT Gene: BIFBRE_00816: Zinc uptake regulation protein ZUR Gene: BIFBRE_00810: Zinc uptake regulation protein ZUR |
Gene: BDP_0716: Zinc uptake regulation protein ZUR |
Gene: BIFGAL_01073: Zinc uptake regulation protein ZUR |
Gene: BL1128: Zinc uptake regulation protein ZUR |
*2
Bifidobacterium longum subsp. infantis ATCC 15697 Gene: Blon_1979: Zinc uptake regulation protein ZUR Site: position = -45 score = 5.08654 sequence = TAACGATAATGAATATCATTT Gene: Blon_1974: Zinc uptake regulation protein ZUR |
Gene: HMPREF0424_1040: Zinc uptake regulation protein ZUR |
Zinc uptake regulation protein ZUR |
| CRON 3. | |||||||||||
| HMPREF0424_1241 |
|
|
|
|
|
|
|
|
|
*
Gardnerella vaginalis 409-05 Site: position = -117 score = 5.55319 sequence = TAATGAGAATCATTATTATTA Gene: HMPREF0424_1241: surface-anchored protein domain protein |
surface-anchored protein domain protein |
| HMPREF0424_1240 |
|
|
|
|
|
|
|
|
|
Gene: HMPREF0424_1240: surface-anchored protein domain protein |
surface-anchored protein domain protein |
| HMPREF0424_1239 |
|
|
|
|
|
|
|
|
|
Gene: HMPREF0424_1239: putative ABC transporter-associated repeat protein |
putative ABC transporter-associated repeat protein |
| znuA3 |
|
|
|
|
|
|
|
|
|
Gene: HMPREF0424_1238: Zinc ABC transporter, periplasmic-binding protein ZnuA |
Zinc ABC transporter, periplasmic-binding protein ZnuA |
| znuC3 |
|
|
|
|
|
|
|
|
|
Gene: HMPREF0424_1237: Zinc ABC transporter, ATP-binding protein ZnuC |
Zinc ABC transporter, ATP-binding protein ZnuC |
| znuB3 |
|
|
|
|
|
|
|
|
|
Gene: HMPREF0424_1236: Zinc ABC transporter, inner membrane permease protein ZnuB |
Zinc ABC transporter, inner membrane permease protein ZnuB |
| CRON 4. | |||||||||||
| czcD |
*
Bifidobacterium adolescentis ATCC 15703 Site: position = -60 score = 5.89065 sequence = TATTGAGAAGCGGTTTCAATA Gene: BAD_1116: Cobalt-zinc-cadmium resistance protein CzcD |
*
Bifidobacterium angulatum DSM 20098 Site: position = -42 score = 5.50982 sequence = TACTGAGAAGCAGTCTCATCT Gene: BIFANG_00989: Cobalt-zinc-cadmium resistance protein CzcD |
Gene: BLA_0791: Cobalt-zinc-cadmium resistance protein CzcD |
*
Bifidobacterium bifidum NCIMB 41171 Site: position = -57 score = 4.72026 sequence = TATTGAAAATGATTGTAGGAA Gene: BbifN4_010100002259: Cobalt-zinc-cadmium resistance protein CzcD |
*
Bifidobacterium breve DSM 20213 Site: position = -211 score = 5.47246 sequence = AAATGAGAAGCGGTTTCAACA Gene: BIFBRE_01806: Cobalt-zinc-cadmium resistance protein CzcD |
*
Bifidobacterium dentium Bd1 Site: position = -128 score = 5.65097 sequence = TATTGAGAAGCGATTTCAGTT Gene: BDP_1557: Cobalt-zinc-cadmium resistance protein CzcD |
Gene: BIFGAL_00304: Cobalt-zinc-cadmium resistance protein CzcD |
*
Bifidobacterium longum NCC2705 Site: position = -42 score = 5.37576 sequence = AAATGAGAAGCGGTTTCAACT Gene: BL1309: Cobalt-zinc-cadmium resistance protein CzcD |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -42 score = 5.65494 sequence = TATTGAGAAGCGGTTTCAACT Gene: Blon_0841: Cobalt-zinc-cadmium resistance protein CzcD |
Gene: HMPREF0424_0669: Cobalt-zinc-cadmium resistance protein CzcD |
Cobalt-zinc-cadmium resistance protein CzcD |
| CRON 5. | |||||||||||
| znuC |
*
Bifidobacterium adolescentis ATCC 15703 Site: position = -65 score = 6.59119 sequence = TATTGAGAATGATTGTCAACA Gene: BAD_0671: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Bifidobacterium angulatum DSM 20098 Site: position = -27 score = 5.93778 sequence = TATTGAAAACGATTGTCAGCA Gene: BIFANG_01134: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Bifidobacterium animalis subsp. lactis AD011 Site: position = -100 score = 6.73021 sequence = TATTGAGAATGATTGTCAATA Gene: BLA_1501: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Bifidobacterium bifidum NCIMB 41171 Site: position = -101 score = 5.77441 sequence = TAATGAGAATGATTGTCATAG Gene: BbifN4_010100003314: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Bifidobacterium breve DSM 20213 Site: position = -43 score = 6.28976 sequence = TATTGAGAACGATTGTCAGCA Gene: BIFBRE_01043: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Bifidobacterium dentium Bd1 Site: position = -68 score = 6.43906 sequence = TATTGAGAATGGTTGTCAACA Gene: BDP_0897: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Bifidobacterium gallicum DSM 20093 Site: position = -103 score = 6.04165 sequence = AAATGGGAATGATTGTCAATA Gene: BIFGAL_00364: Zinc ABC transporter, ATP-binding protein ZnuC |
Gene: BL0995: Zinc ABC transporter, ATP-binding protein ZnuC |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -43 score = 6.28976 sequence = TATTGAGAACGATTGTCAGCA Gene: Blon_1757: Zinc ABC transporter, ATP-binding protein ZnuC |
|
Zinc ABC transporter, ATP-binding protein ZnuC |
| znuB |
Gene: BAD_0670: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: BIFANG_01133: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: BLA_1502: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: BbifN4_010100003309: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: BIFBRE_01042: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: BDP_0896: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: BIFGAL_00365: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: BL0996: Zinc ABC transporter, inner membrane permease protein ZnuB |
Gene: Blon_1758: Zinc ABC transporter, inner membrane permease protein ZnuB |
|
Zinc ABC transporter, inner membrane permease protein ZnuB |
| CRON 6. | |||||||||||
| znuA |
*
Bifidobacterium adolescentis ATCC 15703 Site: position = -27 score = 6.10909 sequence = TGTTGAGAATCATTCTCAGTT Gene: BAD_0282: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Bifidobacterium angulatum DSM 20098 Site: position = -150 score = 5.7589 sequence = TACTGATAACGGTTCTCATTT Gene: BIFANG_00140: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Bifidobacterium animalis subsp. lactis AD011 Site: position = -100 score = 6.15275 sequence = TATTGAGAACGATTCTCACTT Gene: BLA_0332: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Bifidobacterium bifidum NCIMB 41171 Site: position = -89 score = 6.04699 sequence = TAATGATAATAAATCTCAATA Gene: BbifN4_010100006401: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Bifidobacterium breve DSM 20213 Site: position = -287 score = 6.1442 sequence = AAATGATAATAATTCTCAATA Gene: BIFBRE_00824: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Bifidobacterium dentium Bd1 Site: position = -67 score = 6.06726 sequence = TGTTGAGAATCATTCTCATTT Gene: BDP_0392: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Bifidobacterium gallicum DSM 20093 Site: position = -285 score = 5.92483 sequence = TACTGATAATCATTATCAATT Gene: BIFGAL_00753: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Bifidobacterium longum NCC2705 Site: position = -112 score = 6.1442 sequence = AAATGATAATAATTCTCAATA Gene: BL1126: Zinc ABC transporter, periplasmic-binding protein ZnuA |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -113 score = 6.1442 sequence = AAATGATAATAATTCTCAATA Gene: Blon_1963: Zinc ABC transporter, periplasmic-binding protein ZnuA |
|
Zinc ABC transporter, periplasmic-binding protein ZnuA |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |