Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulon of Zur in Gardnerella vaginalis 409-05

Properties
Regulator type: Transcription factor
TF locus tag: HMPREF0424_1040
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Bifidobacteriaceae
Statistics of regulated genes:
- Genes 6
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 33 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -117
Score: 5.6
Sequence: TAATGAGAATCATTATTATTA
Locus tag: HMPREF0424_1241
Name: null
Funciton: surface-anchored protein domain protein
Locus tag: HMPREF0424_1240
Name: null
Funciton: surface-anchored protein domain protein
Locus tag: HMPREF0424_1239
Name: null
Funciton: putative ABC transporter-associated repeat protein
Locus tag: HMPREF0424_1238
Name: znuA3
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: HMPREF0424_1237
Name: znuC3
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: HMPREF0424_1236
Name: znuB3
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
surface-anchored protein domain protein
surface-anchored protein domain protein
putative ABC transporter-associated repeat protein
znuA3
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC3
Zinc ABC transporter, ATP-binding protein ZnuC
znuB3
Zinc ABC transporter, inner membrane permease protein ZnuB
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD