Regulon of Zur in Gardnerella vaginalis 409-05

Properties
Regulator type:	Transcription factor
TF locus tag:	HMPREF0424_1040
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 33 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -117 Score: 5.6 Sequence: TAATGAGAATCATTATTATTA Locus tag: HMPREF0424_1241 Name: null Funciton: surface-anchored protein domain protein Locus tag: HMPREF0424_1240 Name: null Funciton: surface-anchored protein domain protein Locus tag: HMPREF0424_1239 Name: null Funciton: putative ABC transporter-associated repeat protein Locus tag: HMPREF0424_1238 Name: znuA3 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: HMPREF0424_1237 Name: znuC3 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: HMPREF0424_1236 Name: znuB3 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	HMPREF0424_1241		surface-anchored protein domain protein
	HMPREF0424_1240		surface-anchored protein domain protein
	HMPREF0424_1239		putative ABC transporter-associated repeat protein
	HMPREF0424_1238	znuA3	Zinc ABC transporter, periplasmic-binding protein ZnuA
	HMPREF0424_1237	znuC3	Zinc ABC transporter, ATP-binding protein ZnuC
	HMPREF0424_1236	znuB3	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD