Regulon of Zur in Bifidobacterium breve DSM 20213

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFBRE_00816, BIFBRE_00810
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	6
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 33 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -211 Score: 5.5 Sequence: AAATGAGAAGCGGTTTCAACA Locus tag: BIFBRE_01806 Name: czcD Funciton: Cobalt-zinc-cadmium resistance protein CzcD
	BIFBRE_01806	czcD	Cobalt-zinc-cadmium resistance protein CzcD
Position: -287 Score: 6.1 Sequence: AAATGATAATAATTCTCAATA Locus tag: BIFBRE_00824 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	BIFBRE_00824	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -45 Score: 5.1 Sequence: TAACGATAATGAATATCATTT Locus tag: BIFBRE_00816 Name: zur Funciton: Zinc uptake regulation protein ZUR
	BIFBRE_00816	zur	Zinc uptake regulation protein ZUR
Position: -19 Score: 5.7 Sequence: TATTGAGAATTATTATCATTT Locus tag: BIFBRE_00822 Name: rpsN2 Funciton: SSU ribosomal protein S14p
	BIFBRE_00822	rpsN2	SSU ribosomal protein S14p
Position: -43 Score: 6.3 Sequence: TATTGAGAACGATTGTCAGCA Locus tag: BIFBRE_01043 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: BIFBRE_01042 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	BIFBRE_01043	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	BIFBRE_01042	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD